Skip to main content

Table 3 List of probes used for FISH in this study

From: Co-infection and localization of secondary symbionts in two whitefly species

Target symbiont Probe name and dye Sequence (5'-> 3') Reference
Portiera BTP1-Cy3 TGTCAGTGTCAGCCCAGAAG [9]
Rickettsia Rb1-Cy5 TCCACGTCGCCGTCTTGC [9]
Hamiltonella BTH-Cy5/Cy3 CCAGATTCCCAGACTTTACTCA [22]
Cardinium Card-Cy5 TATCAATTGCAGTTCTAGCG [58]
Arsenophonus Ars2-Cy5 TCATGACCACAACCTCCAAA [22]
Wolbachia W1-Cy5 CTTCTGTGAGTACCGTCATTATC [33]