Skip to main content

Table 2 List of primers used in this study

From: Co-infection and localization of secondary symbionts in two whitefly species

Targeted gene Primer name Sequence (5'-> 3') Anealing (°C)/Product Size Reference
Rickettsia
16S rDNA
Rb-F
Rb-R
GCTCAGAACGAACGCTATC
GAAGGAAAGCATCTCTGC
59/~900 [9]
Hamiltonella
16S rDNA
92F
HbR
TGAGTAAAGTCTGGGAATCTGG
AGTTCAAGACCGCAACCTC
62/~700 [10]
Cardinium
16S rDNA
CFB-F
CFB-R
GCGGTGTAAAATGAGCGTG
ACCTMTTCTTAACTCAAGCCT
59/~500 [8]
Arsenophonus
23S rDNA
Ars23S-1
Ars23S-2
CGTTTGATGAATTCATAGTCAAA
GGTCCTCCAGTTAGTGTTACCCAAC
59/~600 [5]
Wolbachia
16S rDNA
Wol16S-f
Wol16S-r
CGG GGGAAAAATTTATTGCT
AGCTGTAATACAGAAAGTAAA
55/~650 [38]
Fritschea
16S rDNA
U23F
23SIGR
GATGCCTTGGCATTGATAGGCGATGAAGGA
TGGCTCATCATGCAAAAGGCA
55/~600 [7]
B/Q biotypes mtCO1 C1-J-2195
L2-N-3014
TTGATTTTTTGGTCATCCAGAAGT
TCCAATGCACTAATCTGCCATATTA
50/~850 [57]
B/Q biotypes micro-sattelite Bem23-F
Bem23-R
CGGAGCTTGCGCCTTAGTC
CGGCTTTATCATAGCTCTCGT
55/Q = 400
B = 200
[56]