Skip to main content

Table 4 Primer sequences used in this study.

From: Candida albicans SUR7 contributes to secretion, biofilm formation, and macrophage killing

Primer Primer sequence (5' → 3')
IPF12442-5DR TTATTCTTTGAATTACTTTCCAACTTACTTCATTCCCAATTGATTAAAGTTATAAAGAATTAAACGAAACGTTTTCCCAGTCACGACGTT
IPF12442-3DR TACGATTTCTTAATCAAATATCAAACTTTAACCCTCTCAAAAAGCTAATAAACTAACATTGATTACTCAATGTGGAATTGTGAGCGGATA
IPF12442-5Det GCTATTCCACTTCCACTTGG
IPF12442-3Det CAAGGGGGGAGAAGAATGGG
SalI-5'-IPF12442 GTTCTGTCGACTTGGTTGGTTGGTTGGTT
NdeI-3'IPF12442 CAATCCATATGTAACTCATGTCACGC
FMP45-5FP GGCGAAAGACTCTCTAATGCATCAAAATTCAGATTTTTTAGAGTGAAAAGAGCCAAATCAGAAGATGTTGGTGGTGGTTCTAAAGGTGAAGAATTATT
FMP45-3HisR2 AAATTCATAATGGGTGTAGTTTAAGCCCAAAAAATTCAACAGTACAATCAATGAGGACTTTTTCTTCATTGAATTCCGGAATATTTATGAGAAAC
FMP45FP-5Det CCCTCGTGGTGAATACGAATC
SUR7-5FP GAAGAAAACACAGGCGGTATTAGATTCTTCAAAATCAAAAGAAACCAAAAAGTTTCCGATGATGAATCAGTAGGTGGTGGTTCTAAAGGTGAAGAATTATT
SUR7-3HisR2 TACGATTTCTTAATCAAATATCAAACTTTAACCCTCTCAAAAAGCTAATAAACTAACATTGATTACTCAAGAATTCCGGAATATTTATGAGAAAC
SUR7FP-5Det CTAGAGCTGCCCCACCAACT
FMP45-3UraR1 AAATTCATAATGGGTGTAGTTTAAGCCCAAAAAATTCAACAGTACAATCAATGAGGACTTTTTCTTCATTTCTAGAAGGACCACCTTTGATTG
ADHTERAS [39] GAGATATCGATCCTAGCGTAG
3FP-URADet GTGACACCATGAGCATTGGT