Skip to main content

Table 2 Forward (FW) and reverse (RV) primers used in real-time PCR for the PLB and LIP genes.

From: Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

Gene Orientation Primer sequence (5' to 3')
PLB1 FW GGTGGAGAAGATGGCCAAAA
  RV AGCACTTACGTTACGATGCAACA
PLB2 FW TGAACCTTTGGGCGACAACT
  RV GCCGCGCTCGTTGTTAA
LIP1 FW AGCCCAACCAGAAGCTAATGAA
  RV TGATGCAAAAGTCGCCATGT
LIP2 FW GGCCTGGATTGATGCAAGAT
  RV TTGTGTGCAGACATCCTTGGA
LIP3 FW TCTCACCGAGATTGTTGTTGGA
  RV GTTGGCCATCAAATCTTGCA
LIP4 FW GCGCTCCTGTTGCTTTGACT
  RV ACACGGTTTGTTTTCCATTGAA
LIP5 FW TGGTTCCAAAAATACCCGTGTT
  RV CGACAATAGGGACGATTTGATCA
LIP6 FW AAGAATCTTCCGACCTGACCAA
  RV ATATGCACCTGTTGACGTTCAAA
LIP7 FW AACTGATATTTGCCATGCATTAGAAA
  RV CCATTCCCGGTAACTAGCATGT
LIP8 FW CAACAATTGCTAAAATCGTTGAAGA
  RV AGGGATTTTTGGCACTAATTGTTT
LIP9 FW CGCAAGTTTGAAGTCAGGAAAA
  RV CCCACATTACAACTTTGGCATCT
LIP10 FW CACCTGGCTTAGCAGTTGCA
  RV CCCAGCAAAGACTCATTTTATTCA