Skip to main content

Table 1 Forward (FW) and reverse (RV) primers used in real-time PCR for the reference genes and for the SAP genes.

From: Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

Gene Orientation Primer sequence (5' to 3')
HWP1 FW GACCGTCTACCTGTGGGACAGT
  RV GCTCAACTTATTGCTATCGCTTATTACA
ACT1 FW TTTCATCTTCTGTATCAGAGGAACTTATTT
  RV ATGGGATGAATCATCAAACAAGAG
RPP2B FW TGCTTACTTATTGTTAGTTCAAGGTGGTA
  RV CAACACCAACGGATTCCAATAAA
PMA1 FW TTGCTTATGATAATGCTCCATACGA
  RV TACCCCACAACTTGGCAAGT
RIP FW TGTCACGGTTCCCATTATGATATTT
  RV TGGAATTTCCAAGTTCAATGGA
LSC2 FW CGTCAACATCTTTGGTGGTATTGT
  RV TTGGTGGCAGCAATTAAACCT
SAP1 FW AACCAATAGTGATGTCAGCAGCAT
  RV ACAAGCCCTCCCAGTTACTTTAAA
SAP2 FW GAATTAAGAATTAGTTTGGGTTCAGTTGA
  RV CCACAAGAACATCGACATTATCAGT
SAP3 FW CAGCTTCTGAATTTACTGCTCCATT
  RV TCCAAAAAGAAGTTGACATTGATCA
SAP4 FW AAACGGCATTTGAATCTGGAA
  RV CAAAAACTTAGCGTTATTGTTGACACT
SAP5 FW CCAGCATCTTCCCGCACTT
  RV GCGTAAGAACCGTCACCATATTTAA
SAP6 FW TGGTAGCTTCGTTGGTTTGGA
  RV GCTAACGTTTGGTCTACTAGTGCTCATA
SAP9 FW AAAGCAGCAGCGGCAGTACT
  RV ATCCAAAACAACACCCGTGGTA
SAP10 FW CCTTATTCGAACCGATCTCCAA
  RV CAATGCCTCTTATCAACGACAAGA