Skip to main content

Table 1 Primers used for RealTime-PCR

From: Biofilm formation and virulence expression by Streptococcus mutans are altered when grown in dual-species model

Primer DNA sequence (5' → 3') Application Amplicon
spaP-Fw TCCGCTTATACAGGTCAAGTTG spaP fragment 121 bp
spaP-Rv GAGAAGCTACTGATAGAAGGGC   
gtfB-Fw AGCAATGCAGCCATCTACAAAT gtfB fragment 98 bp
gtfB-Rv ACGAACTTTGCCGTTATTGTCA   
gbpB-Fw CGTGTTTCGGCTATTCGTGAAG gbpB fragment 108 bp
gbpB-Rv TGCTGCTTGATTTTCTTGTTGC   
luxS-Fw ACTGTTCCCCTTTTGGCTGTC luxS fragment 93 bp
luxS-Rv AACTTGCTTTGATGACTGTGGC   
brpA-Fw CGTGAGGTCATCAGCAAGGTC brpA fragment 148 bp
brpA-Rv CGCTGTACCCCAAAAGTTTAGG   
ldh-Fw TTGGCGACGCTCTTGATCTTAG ldh fragment 92 bp
ldh-Rv GTCAGCATCCGCACAGTCTTC