Skip to main content

Table 6 Primers used for PCR and sequencing

From: Bacterial diversity in faeces from polar bear (Ursus maritimus) in Arctic Svalbard

Name Primer sequence (5'-3') Gene target Reference
BlaF CATTTCCGTGTCGCCCTTATTCC bla TEM [52]
BlaR GGCACCTATCTCAGCGATCTGTCTA bla TEM [52]
TemI3 TGGTTTATTGCTGATAAATCTGGAG bla TEM [15]
TemI5a TTAAAAGTGCTCATCATTGGAAAAC bla TEM [15]
TemI5b CTGTTGAGATCCAGTTCGATGTA bla TEM [15]
16S-27F AGAGTTTGATCCTGGCTCAG 16S rRNA [53]
16S-1494R CTACGGCTACCTTGTTACGA 16S rRNA [53]
Bact338 GCTGCCTCCCGTAGGAGT 16S rRNA [54]