Skip to main content

Table 2 PCR and sequencing primers used in this study. Underlined bases are restriction enzyme sites used in cloning. Bold bases represent either the start codon or stop codon of the gene being cloned.

From: Identification of two Mycobacterium tuberculosis H37Rv ORFs involved in resistance to killing by human macrophages

Primer Sequence (5' to 3') Location/ Function
GGATAGATCTAGTTGCTGCAGCGT 5' end of HSP65 promoter
GAAGTGGATCCTCCGATCGGGGATG 3' end of HSP65 promoter
GACGGATCCATG ACGTCATGAAC 5' end of xylE
GACGGATCCAAGCTTGCATGCC 3' end of xylE
CGGTGTCGCGGGCGGCGGCGTCG 5' end of sur2 probe
GATCGCATTATGAATCTGGCAAACC 3' end of sur2 probe
CAGGGATCCATCGCATTATG AATCTGGCAAACCG 5' end of Rv0365c
CAGGGATCCGTGTTA CCCGAGTGAGCTGACC 3' end of Rv0365c
CAGGGATCCTTA ATCCCAGAACGCCCCGAACACC sur2 end of truncated Rv0365c
GCGGCCGCAGATCTAGTTGCTGCAGCGTGAC 5' end of HSP65 promoter
GCGGCCGCGTGTTACCCGAGTGAGCTGACC 3' end of Rv0365c
GGATCCGACAGGCTAGGGCAGGATCGC 5' end of Rv0365c promoter
GACGGATCCGTTGGGCGATG AAACAGCTTG 5' end of Rv2233
GACGGATCCGGATCA GACACCTAGCGCCTC 3' end of Rv2233
GACAGATCTGTTGGGCGATG AAACAGCTTG 5' end of Rv2233
GACAGATCTGGCGCTAGGTG TCTGATCCGC 5' end of Rv2234
GACAGATCTGCATCA ACTCGGTCCGTTCCG 3' end of Rv2234
GACGGATCCCCGAGTTGATG CCCCCGCC 5' end of Rv2235
GACGGATCCGGTTTA CCGCCGGCGGCC 3' end of Rv2235
GACAGATCTGGTTTA CCGCCGGCGGCC 3' end of Rv2235
GACGGATCCCTGCCGGAGTG TTTGCATCG 5' end of Rv2236c
GACGGATCCCCGCTA CGGCCGCCGGC 3' end of Rv2236c
GACGGATCCCCAGGTCGATG CAAACACTCC 5' end of Rv2237
GACGGATCCGCTCTA TCAGACGATTCGGCG 3' end of Rv2237
GAGGGATCCAAGCGCTGATG CTGAACGTCG 5' end of Rv2238c
GAGGGATCCCCCAAAACCTTA GGCCGTAAG 3' end of Rv2238c
GACGGATCCCGACGATAATG CCCATCGCG 5' end of Rv2239c
GACGGATCCGCATCA GCGCTTGCCAGCC 3' end of Rv2239c
GACGGATCCGCCAGATCGTG GCGGGCG 5' end of Rv2240c
GACGGATCCGCCTCA GAAGGCGGCCACG 3' end of Rv2240c