Skip to main content

Advertisement

Table 1 Oligonucleotides used in this work.

From: Utilization of tmRNA sequences for bacterial identification

Oligonucleotide Sequence 5'-3' * Target tmRNA
B1 ggggacgttacggattcgac, 1–20 B. subtilis
B2 tggagacgccgggagtcgaa, 351–360 B. subtilis
L3 ttaaagccccgcaaaatgtc, 229–248 L. lactis IL1403
L4 gtcaagcctccacaacaacg, 195–214 L. lactis IL1403
L11 acggattcgacagg, 10–23 L. lactis IL1403
L12 gggagtcgaaccc, 234–246 L. lactis IL1403
E1 F-gtggaatccagaatcagcccc, 1–21 E. coli
E2 F-gcgtagttttcgtc, 96–109 E. coli
E3 F-ttgatccccgtcctaagagcgg, 154–175 E. coli
E4 F-tctcttttgggtttgacctctc, 176–197 E. coli
E5 F-tggtggagctggcgggagttgaa, 341–363 E. coli
RNA1 HRP-tgggtttgacctctcttg, 173–190 E. coli
  1. * The type of label is either fluorescein (F-) or horseradish peroxidase (HRP-). Target sites are given after the sequences as nucleotide position numbers of the corresponding tmRNAs.