Skip to main content

Table 2 Description of Bacillus anthracis polymorphic markers

From: A tandem repeats database for bacterial genomes: application to the genotyping of Yersinia pestis and Bacillus anthracis

        Expected   Number   
        product Estimated of Total PIC
Marker U N % V Primer sequences PCR length in size alleles number index
    GC     bp range in B. of  
        (observed) (bp) anthracis alleles  
Ceb-Bams 1 21 16 44 88 L: GTTGAGCATGAGAGGTACCTTGTCCTTTTT   485 410-520 5 5 0.72
      R: AGTTCAAGCGCCAGAAGGTTATGAGTTATC   (520)     
Ceb-Bams 3 15 25 59 73 L: GCAGCAACAGAAAACTTCTCTCCAATAACA   544 480-860 6 9 0.75
      R: TCCTCCCTGAGAACTGCTATCACCTTTAAC 1%      
Ceb-Bams 5 39 10 49 92 L: GCAGGAAGAACAAAAGAAACTAGAAGAGCA 53°C 307 305-385 3 3 0.56
      R: ATTATTAGCAGGGGCCTCTCCTGCATTACC 60s      
Ceb-Bams 7 18 49 55 69 L: GAATATTCGTGCCACCTAACAAAACAGAAA 65°C 1017 600-1950 9 9 0.82
      R: TGTCAGATCTAGTTGGCCCTACTTTTCCTC 1%      
Ceb-Bams 13 9 70 60 79 L: AATTGAGAAATTGCTGTACCAAACT 120s 814 330-850 8 11 0.79
      R: CTAGTGCATTTGACCCTAATCTTGT 1%      
Ceb-Bams 15 18 12 57 77 L: GTATTTCCCCCAGATACAGTAATCC   409 410-610 5 5 0.59
      R: GTGTACATGTTGATTCATGCTGTTT       
Ceb-Bams 21 45 11 43 75 L: TGTAGTGCCAGATTTGTCTTCTGTA   676 540-680 3 3 0.14
      R: CAAATTTTGAGATGGGAGTTTTACT       
Ceb-Bams 22 36 15 39 81 L: ATCAAAAATTCTTGGCAGACTGA   735 590-950 4 6 0.51
      R: ACCGTTAATTCACGTTTAGCAGA       
Ceb-Bams 23 42 11 37 85 L: CGGTCTGTCTCTATTATTCAGTGGT   653 570-820 3 4 0.49
      R: CCTGTTGCTCCTAGTGATTTCTTAC       
Ceb-Bams 24 42 11 44 80 L: CTTCTACTTCCGTACTTGAAATTGG   630 335-670 3 6 0.2
      R: CGTCACGTACCATTTAATGTTGTTA       
Ceb-Bams 25 15 14 45 60 L: CCGAATACGTAAGAAATAAATCCAC   391 375-390 2 2 0.07
      R: TGAAAGATCTTGAAAAACAAGCATT       
Ceb-Bams 28 24 14 36 70 L: CTCTGTTGTAACAAAATTTCCGTCT   493 300-400 3 3 0.26
      R: TATTAAACCAGGCGTTACTTACAGC   (400)     
Ceb-Bams 30 27 16 58 78 L: AGCTAATCACCTACAACACCTGGTA 120s   200-890 11 11 0.77
      R: CAGAAAATATTGGACCTACCTTCC 1%      
Ceb-Bams 31 9 64 58 57 L: GCTGTATTTATCGAGCTTCAAAATCT   772 300-850 4 4 0.32
      R: GGAGTACTGTTTGTTGAATGTTGTTT 1%      
  1. Some structural characteristics of the tandem repeats are presented : U (unit length), N (number of repeats), %GC, V (% of conservation). PCR and electrophoresis conditions are as described in the material and methods section : annealing temperature is 60°C, elongation time is 60 seconds and gels are 2% agarose except when indicated otherwise. The expected product length is deduced from the sequencing data corresponding to the Ames strain. When the Ames strains typing does not fit with the expected value, the observed value is indicated between (). Only one side of the Ceb-Bams30 minisatellite can be identified in the available Ames sequence. The other side was identified in the course of the independent, partial sequencing of B. anthracis strains (Vergnaud and col., unpublished data). Total number of alleles includes alleles observed in the B. cereus strains. Polymorphism Information Index (PIC) or Nei's diversity index is calculated as 1 - Σ (allele frequency)2.