Skip to main content

Table 1 Description of Yersinia polymorphic markers

From: A tandem repeats database for bacterial genomes: application to the genotyping of Yersinia pestis and Bacillus anthracis

        Expected Estimated Number Total
Marker U N % GC V Primer sequences PCR product size range of Alleles number
        length (bp) (bp) in of
          Y.pestis alleles
Markers polymorphic in Yersinia pestis strains
yp0120ms01 18 8 34 86 L: CTAAGCACAATTGTTATGCTGAACC   228 180 - 280 3 4
      R: TACTGAATCTGCTTCATTGTTCAAA      
yp1290ms04 17 8 27 96 L: CGCTGTTGAAGTTTTAGTGTAAGAA   230 160 - 240 3 5
      R: AAATGTAACCTGCCAAACGTG      
yp1935ms05 17 11 36 87 L: CCTCAGTTCATTGTGTAAAATCTCA   291 190 - 300 2 4
      R: GTATTAGCGAGATCACAGATGAGC      
yp2769ms06 60 9 48 64 L: AATTTTGCTCCCCAAATAGCAT 90 s 606 370 - 2500 3 5
      R: TTTTCCCCATTAGCGAAATAAGTA      
yp2916ms07 10 9 44 85 L: ATACCGCTACGATCAGCCTCTAT   184 150 - 200 2 4
      R: ATTTAATATTGATTTTGGGACTTGC      
yp3057ms09 18 33 65 91 L: CGTTACCCTTGTTGCCAATAGT 90 s 682 500 - 820 3 5
      R: ACGCAGAACATGCTTACCTTTTAT      
yp0559ms15 15 10 30 62 L: TTGACCAAGTGTAAAAGGCATAAAT   237 225 - 250 2 2
      R: AAACTATCGCCAGCCATTTTAGTA      
yp1814ms20 15 9 47 74 L: ACAACCTCAGTTTGCCCTTG   253 230 - 250 2 2
      R: GTAAAGAGCGCAATGATCGTACT      
yp1895ms21 18 9 51 76 L: GCTTAAAGCAGATTGATACTCACG   278 220 - 350 3 5
      R: CTGCATGTTCACCGGTTCAG      
yp4042ms35 15 8 41 59 L: CTGTTACCGGTCAAAGTGGATATT   204 195 - 225 2 3
      R: AGGCTCTCCTTATCATTATTTGGTC      
yp4425ms38 16 8 41 86 L: GTGAGGTATAGCTAAACGGTGATGT   233 200 - 380 3 5
      R: CGCCGTAGATTATTTGTCACTTTAT      
yp0581ms40 17 7 28 76 L: GCAATCATTCACCTAACCATATCTC   214 220 - 240 2 2
      R: GTGCAATAGGCGTTGTTGTGTA      
yp0718ms41 17 7 41 75 L: GAAGAAAGCCAGCTAATCTGATG   217 180 - 220 2 2
      R: TAATGAATAGCAACGACAACCAATA      
yp1018ms44 17 7 38 61 L: CAATTCCAACAGCTATTAATGCAA   233 220 - 260 2 3
      R: GAATTTTCATAACACGTTCTTCCTG      
yp1108ms45 12 7 65 79 L: GCATCGGAGACTGGGTAAAC   161 120 - 170 3 4
      R: TTTCTGAGGATTTATCGGTGTGAT      
yp1335ms46 17 7 33 73 L: CAGGTTTTACGTTATTTTCTGAAGG   252 230 - 310 3 4
      R: CAGCATGAAGTATGACGGGTATATTA      
yp2058ms51 18 7 37 65 L: GGTTTTTACCGATATAAATCCTGAG   207 190 - 210 2 2
      R: GACCAAGAAGTTAAGTTGCTTATCG      
yp2612ms54 22 7 28 82 L: GTCCACCATTTTCATACTGTCACTT   281 250 - 300 2 3
      R: GCTCTTTGTTCGATTTTATTGAATG      
yp3060ms56 16 7 21 81 L: AACCGACTGACTCACTTTATATTGG   220 180 - 250 2 4
      R: TTCTTTTCCATTACTCAGCCTGTT      
yp4280ms62 9 7 33 60 L: TTTAGTCTTGATTAAGCTGCGTTTT   240 220 - 310 3 5
      R: ACGGAAGACAACCTTATTATTGATG      
yp1118ms69 16 6 39 82 L: GACGTTGCAACTGCAAAAATAAG   179 165 - 180 2 2
      R: ACTTGTTGTGAAGACCATCACTCT      
yp1580ms70 9 6 32 97 L: AAACCAACGGTTCATATTGAATAAA   146 140 - 170 3 5
      R: CTTCTTCCGCTATTTTCCTACAGA      
yp1925ms71 14 6 45 91 L: GCTACTCGAATATGAGTTAGCCAAA   171 145 - 210 2 4
      R: ATTGCCATATTGGATGCTAAAATAA      
yp3236ms73 18 6 40 89 L: AATACCCTGTGGGTGATAATGAAC   225 175 - 230 2 3
      R: ATCGATTTAGGTACCACCAATTCA      
yp3245ms74 15 6 44 83 L: CCCCGACTTATATCAAGCACTG   195 180 - 225 3 3
      R: AACTGACGATCTTTTTCACTGAGTT      
Markers polymorphic in 5 Yersinia strains (monomorphic in pestis )
yp0802ms02 18 12 49 86 L: CTGACACAAAACGAGAGCCTATTT 53°C 314 240 - 315 1 2
      R: AGCGTGAGTGGGCTATCAATAC 1 min     
yp2925ms08 15 12 39 63 L: AGCCTTTTTGTTGATTATCAGTCAT   270 270 - 290 1 2
      R: CGATAATAATACTGAATTACCGGATG      
yp4411ms10 14 8 32 69 L: ATCATGCTTTTGCCTCAATATAATC   191 190 - 210 1 2
      R: GAAACGCAGTCCCTGTTGTAG      
yp0813ms16 17 8 39 64 L: GTTGGTTATCCGACAGTCTTCAATA   235 230 - 270 1 2
      R: GCAATTCGTTATGGCTTAGTAAAAA      
yp1269ms18 27 9 54 55 L: GCAAAAGCTGAAGCAGATAAAATAG   303 220 - 250 1 2
      R: AAACCACCAAACAAATCATCAAC      
yp2196ms22 20 8 12 55 L: AAACCAACAAGAAAACTGTAACCAC 90 s 265 270 - 1500 1 2
      R: CATTCACCATTGATGTCCTTAGAC      
yp2324ms24 19 8 34 65 L: TTCACCGGGTTACCTTAATTACATA   255 215 - 255 1 2
      R: CTACCTTGCTGTCAACACTCGAC      
yp2331ms25 17 9 36 76 L: AACGCGTTAATAAAACAATAAAGTG   181 190 - 230 1 3
      R: CAATATCCTTTTACTCAGCCGATG      
yp2679ms27 16 8 20 76 L: ATGATTACTGGCAAGAGCACTATGT   217 200 - 220 1 2
      R: AACAAGATCACCTGGTCGTTAAA      
yp2908ms28 18 8 40 69 L: GCAGAAATAATCTTCAGGAGAAACA   242 190 - 290 1 2
      R: AGATCGTCGTTAGTCCATGTCAG      
yp2958ms29 16 8 23 61 L: AAAATAGTCTGTGTTTCAGCAAAGC   215 215 - 245 1 2
      R: CCTTAAAAACCCTAAGTGGGTAAAA      
yp3225ms30 54 11 51 52 L: CAATAATACCATCGTGCGTGATAC   683 680 - 900 1 2
      R: TATTAATGGTGGTGTTAGTCGCTGT      
yp3532ms31 14 8 30 67 L: GTTATTTATTTTTGCCCCAACTTGT   217 215- 245 1 2
      R: TTAGCCTGTTTGTTCTTCAAATAGC      
yp3787ms32 18 8 49 65 L: CGATAACGTTAATGCCATCAGTAG   218 190 - 240 1 3
      R: GCGCCGGTAAGTTTTGTTTATTA      
yp3795ms33 15 8 43 67 L: CCCTTCTTTTTATGCTTGAAGATACT   210 210 - 225 1 2
      R: GTTGAACCACAGGCTGTTGAG      
yp4371ms37 18 8 35 82 L: TACTTAGGCATTGTCTCTTCACTCC   235 235 - 255 1 2
      R: CTGAAATTATCAGTAGGTGGTTCGT      
yp0999ms43 17 7 38 80 L: ATTCCACCACCAACAATTATCAC   211 220 - 300 1 3
      R: GGTATTCGTATTGAAGATGACATTG      
yp1962ms50 18 7 34 71 L: TACCGAGGTATTCCCTGGTCTAAT   225 225 - 240 1 2
      R: AGTTGACTCCCAGTCACTTTTCC      
yp3734ms59 16 7 36 69 L: ATTATCATGACCCTTCCAGTGCTAT   218 200 - 220 1 2
      R: CATCAAAATGCCAGGAGAGTAAC      
yp4338ms63 17 7 38 72 L: ATTAACGATTTCTTGTCGCTCAGT   194 190 - 275 1 3
      R: AATCAGTAACGGCATGTGTCAGTA      
yp0549ms66 18 6 41 83 L: TAAAAGCGTCAACAAAGTAGGTCAT   212 200 - 220 1 2
      R: GTTCCTGTTGTTGAAAATGCTG      
yp0782ms67 18 6 40 90 L: TTCCAGGCTAAAGATATTGACTTTG   248 250 - 270 1 2
      R: CTCGGCTTGTTCTACGTTTAATG      
yp1053ms68 18 6 32 82 L: CCGTTATCTGGTGAAAGTGAACAG   182 175 - 205 1 3
      R: GTCCGGTAGCCTGATTGTTTATT      
yp3634ms75 15 6 36 80 L: ATGTGAGCTTGATTGCTGAGTAGT   210 180 - 210 1 3
      R: TCATATTTTAGGTGTTTTGCCTTTG      
  1. Some structural characteristics of the tandem repeats are presented : U (unit length), N (number of repeats), %GC, V (% of conservation). PCR and electrophoresis conditions are as described in the material and methods section : annealing temperature is 60°C, elongation time is 60 seconds and gels are 2% agarose except when indicated otherwise. Total number of alleles means number of alleles in 3 Y. pestis and 2 Y. pseudotuberculosis strains.