Skip to main content

Table 1 Promoter assay constructs.

From: amiA is a negative regulator of acetamidase expression in Mycobacterium smegmatis

pAGAN pJEM Primer Primer PCR product
number number name sequence position
120/121 12 PACT4 GGATCCATCTACCGGACTGCC 1677–1986
   PACT5 GGATCCGAAGGGACCGCAGTG  
130/131 14/13 PACT6 GGATCCACCAGCCCGACG 1291–1536
   PACT7 GGATCCTGAGCGACGAGT  
160/161 13 PACT10 GGATCCCCGAGCGCGATG 2000–2254
   PACT13 GGATCCACGTAGAAGAGC  
170/171 12 PACT9 GGATCCCTCCTTGCACTC 2758–3026
   PACT12 GGATCCCGCCGTGATCGG  
  1. The regions shown in figure 3 were PCR-amplified from genomic DNA and cloned into pGEM-T (Promega). Primers were designed to contain Bam HI sites at each end. The fragments were then excised as Bam HI fragments and cloned into one of the pJEM vectors to give in-frame fusions to the promoterless β-galactosidase gene. The position of the PCR product with respect to the complete acetamidase region is given (assembled from Accession numbers U63095 and X57175).