The Bacillus anthracis chromosome contains four conserved, excision-proficient, putative prophages

  • Shanmuga Sozhamannan1Email author,

    Affiliated with

    • Michael D Chute1,

      Affiliated with

      • Farrell D McAfee1,

        Affiliated with

        • Derrick E Fouts2,

          Affiliated with

          • Arya Akmal1,

            Affiliated with

            • Darrell R Galloway1, 3,

              Affiliated with

              • Alfred Mateczun1,

                Affiliated with

                • Leslie W Baillie1, 3 and

                  Affiliated with

                  • Timothy D Read1, 3

                    Affiliated with

                    BMC Microbiology20066:34

                    DOI: 10.1186/1471-2180-6-34

                    Received: 22 November 2005

                    Accepted: 06 April 2006

                    Published: 06 April 2006

                    Abstract

                    Background

                    Bacillus anthracis is considered to be a recently emerged clone within the Bacillus cereus sensu lato group. The B. anthracis genome sequence contains four putative lambdoid prophages. We undertook this study in order to understand whether the four prophages are unique to B. anthracis and whether they produce active phages.

                    Results

                    More than 300 geographically and temporally divergent isolates of B. anthracis and its near neighbors were screened by PCR for the presence of specific DNA sequences from each prophage region. Every isolate of B. anthracis screened by PCR was found to produce all four phage-specific amplicons whereas none of the non-B. anthracis isolates, produced more than one phage-specific amplicon. Excision of prophages could be detected by a PCR based assay for attP sites on extra-chromosomal phage circles and for attB sites on phage-excised chromosomes. SYBR-green real-time PCR assays indicated that prophage excision occurs at very low frequencies (2 × 10-5 - 8 × 10-8/cell). Induction with mitomycin C increased the frequency of excision of one of the prophages by approximately 250 fold. All four prophages appear to be defective since, mitomycin C induced culture did not release any viable phage particle or lyse the cells or reveal any phage particle under electron microscopic examination.

                    Conclusion

                    The retention of all four putative prophage regions across all tested strains of B. anthracis is further evidence of the very recent emergence of this lineage and the prophage regions may be useful for differentiating the B. anthracis chromosome from that of its neighbors. All four prophages can excise at low frequencies, but are apparently defective in phage production.

                    Background

                    The genome sequence of the bioterrorism pathogen, Bacillus anthracis Ames strain, revealed the presence of four putative lambdoid prophages (designated lambdaBa0l, lambdaBa02, lambdaBa03 and lambdaBa04), constituting about 3% of the 5.2 Mbase main chromosome [1]. Comparative genomic hybridization studies showed that the prophage regions made up a higher percentage of the unique genes in B. anthracis not found in 19 other Bacillus cereus group strains [1]. DNA sequences of all completed and shotgun genome sequences of the diverse B. anthracis strains submitted to genbank (Genbank IDs: AE016879, AE017334, AAAC01000001, AAEQ00000000, AAER00000000,. AAES00000000, AAEN00000000, AAE00000000, AAEP00000000) also contain these prophage sequences with >99% nucleotide sequence identity. B. anthracis appears to be a recently emerged clone within the B. cereus sensu lato group [26]. Multilocus sequence typing (MLST) and other strain typing studies have revealed extensive similarities and very few differences among widely distributed strains [1, 35, 712]. While other B. cereus group genomes also contain lambdoid prophages, these generally contain genes with little DNA sequence homology to B. anthracis prophage genes [1, 1316]. Furthermore, analysis of the four other sequenced B. cereus genomes (Genbank accession numbers ATCC 10987, AE017194; ATCC 14579, AE016877; G9241, AAEK00000000; ZK, CP000001) revealed that prophages are generally inserted at different chromosomal loci than B. anthracis, except in B. cereus ZK strain that contains an element very similar to B. anthracis lambdaBa01 inserted at the same locus. Interestingly, at the same locus in the B. cereus 14579 chromosome, is a defective prophage, phi6A53, with little similarity to B. anthracis lambdaBa0l. These findings probably reflect what has been observed in other bacterial species: prophage acquisition and loss is quite dynamic, and the gene pool of phages that infect the B. cereus group is larger and more diverse than that of the rest of the chromosome [1, 1316].

                    Prophages, like plasmids, conjugative transposons, insertion sequences, introns and other elements, make up a mobile portion of bacterial genome subject to frequent horizontal exchange that often account for large-scale genomic rearrangements and insertions and deletions in bacterial chromosomes. These mobile elements often encode traits such as virulence markers and antibiotic resistance determinants, which confer selective advantages for the host bacterium in various environments [1719].

                    The role of prophages in the pathogenic life cycle of B. anthracis is not known and the majority of the genes on the B. anthracis prophages do not have an assigned function. In our attempts to initiate a study of the role of the prophages, it was determined that markers for the four prophages are conserved in diverse B. anthracis strains and shown that all four prophages are able to excise from the genome but fail to form viable phage particles and hence appear to be defective.

                    Results

                    B. anthracis prophages are common to all strains

                    Earlier comparative genome sequence analysis of B. anthracis and 19 of its close neighbors indicated the absence of the four B. anthracis prophages in other strains [1]. The presence of these or similar prophages in a larger collection of Bacillus spp strains was tested to gain insights into the evolutionary history of B. anthracis as a species. The PCR primers used in the screening were designed to amplify genes that were found to be unique to each B. anthracis prophage from comparative genomic hybridization studies [16]. The PCR primers and the expected sizes of the PCR products are listed in Table 1. A set of 300 strains was screened by PCR. It included 192 B. anthracis strains from the Biological Defense Research Directorate (BDRD) collection isolated from different geographic regions around the world over a time span of several decades. The set also included 24 diverse genotypic strains identified by the multi-locus variable number of tandem repeat methodology [4]. The set of non-B. anthracis strains was primarily from the collection of F. Priest [12] and included 60 B. cereus strains and 48 other Bacilli spp strains. These strains have been characterized extensively by MLST and grouped into distinct sequence types [12]. All B. anthracis strain DNAs produced all the four phage-specific amplicons.
                    Table 1

                    Primers Used in PCR screening of Phage Genes and Phage Excision Products

                       

                    Primer

                    PCR product

                    Location

                    Primer Name

                    ORF/gene product

                    Sequence 5' to 3'

                    Length

                    Size (bp)

                     

                    ORF01192Fa

                    BA0479-hypothetical

                    AAACCCTGGGACCTCTGAAC

                    20

                    1002

                    prophage 04

                    ORF01192Ra

                    BA0479-hypothetical

                    GGAAGAATCGCACGACCATC

                    20

                     

                    prophage 04

                    ORF02190Fa

                    BA5356-Terminase, large subunit

                    GACATCGTTGCACCTTCACAAG

                    22

                    1462

                    prophage 03

                    ORF02190Ra

                    BA5356-Terminase, large subunit

                    CCAAATGTCGAGCATCTTGTTC

                    22

                     

                    prophage 03

                    ORF03655 Fb

                    BA4094-Terminase, large subunit

                    TTGATCGATCCATCTCCTGAAC

                    22

                    1192

                    prophage 02

                    ORF03655 Rb

                    BA4094-Terminase, large subunit

                    GATCAACTTTAGCCTGCGGAAC

                    22

                     

                    prophage 02

                    Ba02 #7 Forc

                    BA4094-Terminase, large subunit

                    CAAAGACAGATCCACCTGGAC

                    21

                    304

                    prophage 02

                    Ba02#7 Revc

                    BA4094-Terminase, large subunit

                    CAAAGGGAGGTTCAGCATCTC

                    21

                     

                    prophage 02

                    ORF03991 Fa

                    BA3805-Acyl transferase

                    AGTTGCATGCCCAGTTCTTG

                    20

                    1205

                    prophage 01

                    ORF03991 Ra

                    BA3805-Acyl transferase

                    CTGCGTGACTGGAATCCCTTAC

                    22

                     

                    prophage 01

                    Ba04INF

                    LambdaBa04 left junction

                    CCAGTTGAATCCAGAACAAACG

                    22

                    871

                    prophage 04

                    Ba04OUTR

                    LambdaBa04 left junction

                    GGGCAGTCATACGAGGATAATG

                    22

                    (961,865)d

                    prophage 04

                    Ba04OUTF

                    LambdaBa04 right junction

                    CCTTCGCTTTGAATTCCTTCTC

                    22

                    997

                    prophage 04

                    Ba04INR

                    LambdaBa04 left junction

                    GAATTGTAACGAGCATGGAAGC

                    22

                     

                    prophage 04

                    Ba03INF

                    LambdaBa03 left junction

                    ACGTTACCCCTATTTCCGAAGC

                    22

                    938

                    prophage 03

                    Ba03OUTR

                    LambdaBa03 left junction

                    CATTTTAATGCGCCCACGAC

                    20

                    (923, 952)d

                    prophage 03

                    Ba03OUTF

                    LambdaBa03 right junction

                    TTCCACATCTTCCTTCAGCAAC

                    22

                    977

                    prophage 03

                    Ba03INR

                    LambdaBa03 left junction

                    GGCCGTACTGGCTTAACTTCTG

                    22

                     

                    prophage 03

                    Ba02INF

                    LambdaBa02 left junction

                    TCACTTGCCAGTCTTGACCTTG

                    22

                    891

                    prophage 02

                    Ba02OUTR

                    LambdaBa02 left junction

                    GGTGCATAAGGCGGTAAAGATG

                    22

                    (861,962)d

                    prophage 02

                    Ba02OUTF

                    LambdaBa02 right junction

                    GGCGAGGTATTAGCTTTACAGTGG

                    24

                    976

                    prophage 02

                    Ba02INR

                    LambdaBa02 left junction

                    GTCCATCTTCACTGCCGAAAC

                    21

                     

                    prophage 02

                    Ba011NF

                    LambdaBa01 left junction

                    ACAAATTCAGTTGCGCTTCC

                    20

                    1053

                    prophage 01

                    Ba010UTR

                    LambdaBa01 left junction

                    TGCAGCACCTACACTGAAACAAG

                    23

                    (878, 1047)d

                    prophage 01

                    Ba010UTF

                    LambdaBa01 right junction

                    CGATGGAAAGTTCTTACCGAAG

                    22

                    915

                    prophage 01

                    Ba011NR

                    LambdaBa01 left junction

                    ATGATGCTCGTCACTTCATCG

                    21

                     

                    prophage 01

                    gmk F

                    BC guanylate kinase, putative

                    ATTTAAGTGAGGAAGGGTAGG

                    21

                    500

                    chr

                    gmk R

                    BC guanylate kinase, putative

                    GCAATGTTCACCAACCACAA

                    20

                     

                    chr

                    PA1 For

                    Protective antigen

                    ATCACCAGAGGCAAGACACC

                    20

                    311

                    pXO1

                    PA1 Rev

                    Protective antigen

                    CCATTGTTTCAGCCCAAGTT

                    20

                     

                    pXO1

                    bla F

                    Amp resistance

                    TTACCAATGCTTAATCAGTGAGGC

                    24

                    861

                    plasmid

                    bla R

                    Amp resistance

                    ATGAGTATTCAACATTTCCGTGTC

                    24

                     

                    plasmid

                    Primers Used in Real Time PCR for determination of Phage Excision Frequencies

                         

                    Bce_glpR

                    BC glycerol kinase

                    GCAGTAGCGGTTGCAGCATA

                    20

                    150

                    chr

                    Bce_glpF

                    BC glycerol kinase

                    CCCGATAATTGCCCCAATC

                    19

                     

                    chr

                    Ba04circF

                    LambdaBa04 circle junction

                    TCAAACCCATCAACAATTTCATTG

                    24

                    129

                    Extra-chr

                    Ba04circR

                    LambdaBa04circle junction

                    CAATAGAATGCACAACAGTGACATAAGT

                    28

                     

                    Extra-chr

                    Ba03circF

                    LambdaBa03 circle junction

                    CAAGGGTTGTAGCTGATAGCTCATT

                    25

                    170

                    Extra-chr

                    Ba03circR

                    LambdaBa03 circle junction

                    TGACAAAGTTCAGTCGATTTTTTTCT

                    26

                     

                    Extra-chr

                    Ba02circR

                    LambdaBa02 circle junction

                    GACCACAACTTGTACCACATTTATTATTT

                    29

                    166

                    Extra-chr

                    Ba02circF

                    LambdaBa02 circle junction

                    CCGCAATATAGGTGGTATAATGCA

                    24

                     

                    Extra-chr

                    Ba01circF

                    LambdaBa01 circle junction

                    CCCACAAAATAAAAAAACCCTCAA

                    24

                    150

                    Extra-chr

                    Ba01circR

                    LambdaBa01 circle junction

                    ACGTTTTTGGCGCAATTTAAA

                    21

                     

                    Extra-chr

                    Ba04mtF

                    LambdaBa04 deleted junction

                    AGCACGTGATGTACAAGCGTTAA

                    23

                    150

                    φ free chr

                    Ba04mtR

                    LambdaBa04 deleted junction

                    TATTCCCTCATATCATGAGGGAATATG

                    27

                     

                    φ free chr

                    Ba03mtF

                    LambdaBa03 deleted junction

                    TGGCCAAATCAAAACTGGTTCT

                    22

                    165

                    φ free chr

                    Ba03mtR

                    LambdaBa03 deleted junction

                    TTCTCACGGTCTGTCGTTATTTTC

                    24

                     

                    φ free chr

                    Ba02mtF

                    LambdaBa02 deleted junction

                    ATATCACCTCAAGGCAACAAACAA

                    24

                    150

                    φ free chr

                    Ba02mtR

                    LambdaBa02 deleted junction

                    GGTAATCTCTCCTTTCGATGTAGCA

                    25

                     

                    φ free chr

                    Ba01mtF

                    LambdaBa01 deleted junction

                    CATTAGGAGATCACTTACTTGAGCACTT

                    28

                    161

                    φ free chr

                    Ba01mtR

                    LambdaBa01 deleted junction

                    CACAAATAAAAAAACCTTGATACCGTAGT

                    29

                     

                    φ free chr

                    Primers Used in Real time PCR screening of Prophage Genes

                      

                    Primer

                    PCR product

                    Location

                    Ba04-RT-F

                    BA0479-hypothetical

                    TATAATGGGCACTCCATTTTGGT

                    23

                    150

                    prophage 04

                    Ba04-RT-R

                    BA0479-hypothetical

                    TCCACAGTGGCATTTACCTTTG

                    22

                     

                    prophage 04

                    Ba03-RT-F

                    BA5356-Terminase, large subunit

                    TCCTATCGAGAATGGGTTCAACTAT

                    25

                    150

                    prophage 03

                    Ba03-RT-R

                    BA5356-Terminase, large subunit

                    GCGTCCCTACCGTTCAACTG

                    20

                     

                    prophage 03

                    Ba02-RT-F

                    BA4094-Terminase, large subunit

                    TGCGTTTTATCATGGAAAATGC

                    22

                    150

                    prophage 02

                    Ba02-RT-R

                    BA4094-Terminase, large subunit

                    TGAGCCAGGTGCTCGTGTT

                    19

                     

                    prophage 02

                    Ba01-RT-F

                    BA3805-Acyl transferase

                    CACTTGAATCAACTGGTATCGTGAA

                    25

                    150

                    prophage 01

                    Ba01-RT-R

                    BA3805-Acyl transferase

                    AAATCCAAATTGAGGCATATGATGA

                    25

                     

                    prophage 01

                    asimplex and multiplex; bsimplex only; cmultiplex only; dsizes of PCR products of phage circle and phage excised chromosomal junction respectively

                    Out of the 108 non-anthracis strains, 88 strains did not amplify any of the B. anthracis phage specific amplicons whereas 20 of them amplified only lambdaBa02 specific DNA fragment. Thus, presence of all the four prophages appears to be a unique feature of B. anthracis strains.

                    Further verification of the presence of all four phage specific sequences was done by a multiplex PCR assay. The primers used for this assay and the expected sizes of the amplification products are listed in Table 1. All the 192 B. anthracis strains but none of the 108 non-anthracis strains produced four amplicons of the expected lengths. Inclusion of a pair of primers targeted to a housekeeping gene (gmk) [12] as a positive control in the multiplex reaction resulted in amplification of that fragment in all strains tested. The results with a fraction of the strains tested are shown in Figure 1a and 1b. As expected from simplex PCR results described above, all the B. anthracis strain DNAs produced all the four PCR products in the multiplex assay. These data indicated that the sequences of the prophage regions might be useful for differentiating the B. anthracis chromosome from that of its neighbors.
                    http://static-content.springer.com/image/art%3A10.1186%2F1471-2180-6-34/MediaObjects/12866_2005_Article_247_Fig1_HTML.jpg
                    Figure 1

                    Multiplex PCR assay for confirmation ofB. anthracisDNA. Multiplex PCR analysis of B. cereus and B. anthracis strains using primers (ORF01192 F-R, ORF02190 F-R, ORF03655 F-R and lambda Ba02 #7 For-Rev). K-1 kb plus ladder (Invitrogen, Inc); E-E-gel low-range marker (Invitrogen, Inc). Lanes 1–9 are B. cereus strains; S74, S363, SPS2, F3080B, F3942/87, F4801/72, m1292, F4801 and S710 respectively. Lane 10-B. anthracis strain 34F2, Lane 11-B. cereus G9241 and Lane 12-reaction control. Panel A reactions were carried out with the multiplex primer set and panel B reactions were carried out with a primer pair for a house-keeping gene gmk in addition to the multiplex primer set.

                    All four Bacillus anthracis prophages are excision-proficient

                    The stability of B. anthracis prophages was analyzed by determining their excision proficiency. The B. anthracis chromosomal regions in and around the prophage insertion sites were examined for the presence of putative attL and attR-like sites. As shown in Figure 2, all prophage sequences are flanked by direct repeats, suggesting probable site-specific recombination mediated insertion of the phage genomes. However, the repeats are of varying lengths for the four phages (lambdaBa04-13 bp, lambdaBa03-108 bp, lambdaBa02-12 bp, and lambdaBa01-65 bp). Also, in lambdaBa0l and lambdaBa03 the direct repeats are not perfect, but have two mismatches (Figure 2). These repeats are present as a single copy at the same chromosomal locus in B. cereus group genomes that do not have inserted phages.
                    http://static-content.springer.com/image/art%3A10.1186%2F1471-2180-6-34/MediaObjects/12866_2005_Article_247_Fig2_HTML.jpg
                    Figure 2

                    DNA sequences around the prophage insertion sites inB. anthracischromosome. The genomic positions in the strain Ames ancestor (Genbank accession number: AE017334) are indicated above the sequence. The sequences of the primers used in PCR of prophage excised chromosomal attB sites are underlined. The putative att sites, referred as left and right repeats, flanking the prophage genome (indicated by boxes with the phage genome size in bp), are highlighted. The left and right repeats of prophages lambda Ba01 and Ba03 are not perfect and the 2 mismatched bases are indicated in different color.

                    Lambdoid prophage, upon excision from the chromosome, by a site-specific recombination event between the attL and attR sites, is expected to generate an extra-chromosomal phage circle and a chromosome with an empty site devoid of the phage genome. In order to test whether B. anthracis prophages spontaneously excise from the chromosome, a PCR based assay was designed to detect phage excision products (Figure 3-top panel) [20]. The nucleotide sequences of the primers and the lengths of the expected PCR products are indicated in table 1. Genomic DNA prepared from stationary phase cultures of B. anthracis non-pathogenic Sterne strain 34F2 (pXOl+, pXO2-) was used as template in conjunction with the various primer pairs in PCR reactions and the PCR reaction products were analyzed by agarose gel electrophoresis (Figure 3-bottom panel). PCR products resulting from the prophage-chromosomal junctions and an internal phage fragment (lanes labeled a, b and e) from all 4 prophage regions were visible. However, in three different experiments, the intensities of the PCR products resulting from phage circles (lanes labeled c) and phage free chromosomes (lanes labeled d) of the four phages were weak. In some cases, the PCR products were not visible (lambdaBa03-c, lambdaBa02-c and lambdaBa0lc-d). Similar results were obtained when plasmid preparation or whole cell lysate of strain 34F2 were used as PCR templates (data not shown). These differences could reflect the very low frequencies of the excision events or the inefficient PCR amplification with those primer pairs. In order to address this issue and to verify whether the PCR products seen on the gel result from excision events and not from non-specific amplification, they were cloned into PCR Topo Cloning vector and sequenced. In all cases, [except in lambdaBa02 circle (lane c) and lambdaBa0l phage excised chromosomal site (attB site PCR) (lane d)], the sequences of the inserts corresponded to the expected sequence with a single att site resulting from the excision of the phage genome from the chromosome (Figure 2). In the case of lambdaBa02 circle and lambdaBa0l phage excised chromosomal site, the concentration of the PCR products was probably too low for successful cloning.
                    http://static-content.springer.com/image/art%3A10.1186%2F1471-2180-6-34/MediaObjects/12866_2005_Article_247_Fig3_HTML.jpg
                    Figure 3

                    Top panel: A model for site-specific recombination mediated prophage excision. The top line shows a schematic representation of the prophage in the chromosome with the att sites indicated by colored boxes. Excision of the prophage via site-specific recombination between the attL and attR sites results in a phage free chromosome (with attB) and the phage circle (with attP). Small numbered arrows indicate the location of the different primers used to detect prophage excision products and the blue bars (marked a-e) indicate the resulting PCR products. The primers indicated 1–6 correspond to 1-INF, 2-OUTR, 3-OUTF, 4-INR, 5-F and 6-R primers respectively for each prophage. Bottom panel: Agarose gel electrophoretic analysis of PCR products resulting from prophage excision inB. anthracisSterne strain 34F2. The set marked as controls corresponds to PCR reactions designed to amplify pag gene (pXOl marker), gmk gene (chromosomal marker) and a negative control amp (pBR322) gene. The four sets of 5 reactions each corresponding to the four prophages is indicated on the lanes by a-e. The corresponding locations of the fragments a-e are shown in panel A.

                    Excision of the four prophages in stationary phase cultures occurs at low frequencies

                    The frequency of spontaneous excision of prophages from B. anthracis chromosome was determined using a SYBR-green real-time PCR assay. Genomic DNA extracted from stationary phase cultures of Sterne strain 34F2 was used as template. A chromosomal housekeeping gene (glp) was amplified as the control with varying template concentrations to generate a standard curve and the copy number of the PCR products of the phage circles and phage-free empty sites were determined using this standard curve (Figure 4). The phage circles and phage-excised chromosomes were present at very low copies ranging from 8 × 10-8 to 2 × 10-5 per chromosomal copy (glp) (Table 2). Cloning and sequencing of the PCR products confirmed their sequences as expected (data not shown). Assuming that the excised phage circle does not undergo replication and that there is one copy of glp per cell, the frequencies of excision/cell were estimated to be similar to the copy numbers of the PCR products. Induction of the 34F2 culture with 0.2 μg/ml of mitomycin C (a DNA damaging agent that is known to induce prophages) increased the frequency of excision of lambda Ba04 by about ~250 fold whereas the other three prophages showed no appreciable increase in excision frequencies.
                    Table 2

                    Frequency of excision of the four prophages from B. anthracis chromosome

                    Excision product

                    Frequency of excision*

                    LambdaBa04 circle

                    2.1 × 10-5

                    LambdaBa04 empty site

                    ND

                    LambdaBa03 circle

                    6.4 × 10-6

                    LambdaBa03 empty site

                    3.7 × lO-6

                    LambdaBa02 circle

                    7.7 × 10-8

                    LambdaBa02 empty site

                    2.8 × 10-7

                    LambdaBa01 circle

                    2.2 × 10-6

                    LambdaBa01 empty site

                    3.4 × 10-7

                    ND-Not determined; *glp std-standard curve for estimating the copy number of different PCR products was generated using glp amplicon (representative of a single copy of chromosome)

                    http://static-content.springer.com/image/art%3A10.1186%2F1471-2180-6-34/MediaObjects/12866_2005_Article_247_Fig4_HTML.jpg
                    Figure 4

                    SYBR green 1 dye PCR assay to determine the frequency of prophage excision. The amplification profiles in triplicates (marked 1–6) with varying concentrations of the template DNA (34F2 genomic DNA) and primer pairs are shown. The corresponding template concentrations and the fragments amplified are as follows: 1-1 ng/glp, 2-100 pg/glp, 3–10 pg/glp, 4-1 pg/glp, 6-100 fg/glp, 5-100 ng/Ba03mtF and R. The standard curve generated from the glp set is shown on the right panel.

                    B. anthracis prophages are apparently defective

                    We conducted a limited analysis to check whether the excised phage genome proceeds to replicate and produce phage particles by testing the unconcentrated culture supernatants for plaque formation on 96 different Bacillus sp. strains including the Bacillus anthracis Sterne strain 34F2. We hypothesized that any spontaneous repressor mutants of the prophages would be able to overcome the superinfection immunity and form plaques on 34F2. No plaque was visible even with the mitomycin C induced culture supernatant on any of the indicator strains tested. In accordance with this result, unconcentrated culture supernatants did not show any increase in SYBR-green based real time PCR amplicons directed against all four phage specific genes in comparison to a chromosomal gene (glp). These amplicons probably resulted from free genomic DNA and not due to the presence of phage particles in culture supernatants since the amount of these amplicons decreased upon DNase treatment of the culture supernatants (data not shown). Electron microscopic analysis of the mitomycin induced and concentrated culture supernatant revealed no intact phage particle or phage components (data not shown).

                    Discussion

                    This study shows that PCR amplicon markers for the four lambdoid prophages found on the B. anthracis Ames strain chromosome are present in all of a large number of diverse B. anthracis strains tested. Genome sequence analysis could not predict the functionality of the phages since all prophages appear to have a full complement of phage genes. All prophages were demonstrated to be excision proficient and the prophage excision frequency reported here is comparable to that seen in another Gram-positive species, Lactobacillus lactis measured by real-time PCR. In that case, the frequency of spontaneous prophage induction varied from 10-7-10-1/cell depending on the conditions examined [20]. In a limited analysis performed in this study, no viable phage production was observed upon mitomycin C induction as determined by plaque assays using nearly 100 diverse Bacillus spp strains as indicators. Although mitomycin C induction exhibited a significant growth inhibition, there was no obvious cell lysis characteristic of phage induction. Direct electron microscopic examination of the concentrated culture supernatants failed to reveal any intact or defective phage particle. This result is in contradiction with an earlier report that polyethylene glycol-concentrated culture supernatants of a B. anthracis Sterne strain showed defective phage particles/phage components under electron microscopic examination [21] and is probably due to strain differences or the method used for concentration of the culture supernatant.

                    There are several possible explanations for the apparent failure in detecting viable phage particles. 1) We have not found an appropriate phage sensitive strain in the panel of 96 strains used in this study for the plaque assay, which might be due to the absence of the phage receptor in these strains. Even if any of the strains possess the receptor, they may lack some other factor needed for phage growth as was shown in the case of γ phage infection of a B. thuringiensis strain that possesses the γ phage receptor, the gamR gene [22]. Similarly, in another study six phages isolated from B. anthracis were screened for their host range and only 2 out of 64 non-anthracis strains tested were susceptible to two of the phages [23]. 2) We have not found a repressor mutant that can overcome superinfection immunity and form plaques on 34F2. 3) The fact that all four prophages are simultaneously defective in their ability to produce viable phage particle or lyse the host cell may be indicative of a defective host factor that is involved in phage life cycle.

                    Although the failure of plaque formation even on closely related species does not necessarily indicate that phages are defective, further work is needed to unequivocally establish this fact. One approach to show that the phages are defective would be to test for plaque formation on the parental carrier strain cured of the respective prophages. Our future studies will focus on testing this possibility.

                    All four prophages contain genes encoding recombinases and terminal-repeat DNA motifs that may function as attachment (att) sites. However, the lambdaBa0l recombinase (GBAA3832) is a pseudogene owing to a frameshift mutation. We hypothesize that lambdaBa0l might recruit some other site-specific recombinase enzyme for its excision, or have a mechanism for frameshift correction during translation. Alternatively, prophage excision might occur via recA mediated general recombination pathway, in which case, the frequency of excision will increase with the increase in the length of the repeats and the products will be identical to the site-specific recombination products.

                    In Escherichia coli, prophage excision is classically triggered as a response to DNA damage [24]. In this regard, B. anthracis possesses some of key components of an active SOS response system, including a lexA ortholog. Despite the fact that there is an intron in the B. anthracis recA gene, the encoded protein is still apparently functional [25]. The results of mitomycin C induction experiment described here supports the role of DNA damage in induction of some prophages.

                    Excision proficient prophage sequences are generally not considered useful targets for bacterial identification because of their instability. However, the constant presence of all four prophages can be advantageous for the definitive discrimination of B. anthracis from all its neighbors. There are several schemes for molecular detection of B. anthracis DNA using unique markers present on virulence plasmids pXO1 and pXO2 [2628] but there are relatively few unique chromosomal targets. Targets for confirmation of B. anthracis chromosomal DNA include using 16S rDNA sequences [29], rpoB [30, 31], gyrB [6], gyrA [32], spore structural protein gene sspE [26] and S-layer protein gene sap [33] for discrimination of B. anthracis from other Bacillus spp. Several multiplex PCR assays have also been described for B. anthracis detection and discrimination [3436]. One multiplex PCR assay described earlier entailed amplification of unique fragments identified through suppression subtractive hybridization (SSH) and several of these were located on prophage regions [35]. Because of the close relatedness of the B. anthracis to B. cereus group strains, many of the PCR based detection techniques are prone to false positive identification of non-anthracis strains. The prophages are unique to B. anthracis and are present in all B. anthracis strains examined so far. Failure to produce the B. anthracis specific signals in multiplex PCR would be the result of simultaneous excision of all four prophages, which is highly unlikely. Hence they may offer unique signatures for B. anthracis chromosome. From an evolutionary standpoint, it seems possible that the conservation of the phages in all B. anthracis may be due to the very recent emergence of the lineage.

                    Conclusion

                    All the B. anthracis strains and none of the non-anthracis strains tested in this study possess the four prophages, as indicated by the presence of phage specific amplicons suggesting that the prophage regions are unique and can be used for distinguishing B. anthracis chromosome from other close relatives. The four prophages excise from the genome at low frequencies; however, in the limited analysis performed in this study, they do not appear to result in production of any viable phage particle or cell lysis, suggesting that the phages may be defective.

                    Methods

                    Bacterial strains, growth and storage conditions

                    The bacterial cultures were stored in 15% glycerol at -70°C. The number of strains of each Bacillus species from the Biological Defense Research Directorate (BDRD) collection is as follows: 192 B. anthracis, five B. cereus, two B. megaterium, two B. mycoides, one B. pumilus and one untyped Bacillus species. A second collection of strains was obtained from F. Priest (Heriot-Watt University, UK) and contained the following strains: 55 B. cereus, three B. mycoides, one B. pseudomycoides, eight B. thuringiensis, two B. weihenstephanensis and the following B. thuringiensis serovars: three aizawai, one albolactis, four canadensis, one dakota, two darmstadiensis, one entomocidus, one fluorescens, two galleriae, one israeliensis, one kenyae, two kumamotoensis, one kurstaki, three morrisoni, one pakistani, two sotto and one terminalis.

                    Genomic DNA extraction and PCR

                    Bacteria were grown in Brain Heart Infusion (BHI) broth and genomic DNA extraction was carried out using Wizard Genomic DNA extraction kit (Promega Corp, Madison, Wi) following the manufacturer's recommended procedures. PCR primers (Table 1) were designed using the eprimer3 software [37] and PCR reactions were carried out using Platinum PCR Supermix (Invitrogen, Inc. Carlsbad, CA) under the following conditions: an initial denaturation cycle at 94°C for 2 min, followed by 32 cycles of denaturation, annealing and extention at 92°C for 30 sec, 56°C for 30 sec, and 72°C for 2 min respectively, followed by a final extension cycle at 72°C for 5 min, in a Dyad Cycler (MJ Research, Inc). The PCR products were initially run on 2% E-gel (Invitrogen, Inc. Carlsbad, CA) and then further verified by running on a 1% agarose gel in TAE buffer.

                    Determination of prophage excision

                    Spontaneous excision of prophages from B. anthracis chromosome was determined using genomic DNA prepared from 1.5 ml of overnight culture in BHI medium of a B. anthracis Sterne strain, 34F2. The primers and the expected sizes of the PCR products of the phage circles and phage excised chromosomal attB sites are listed in Table 1.

                    Sequencing of phage excision products

                    The PCR products of the in vivo prophage excision reaction were cloned into Topo cloning vector (Invitrogen, Inc. Carlsbad, CA), and the inserts were sequenced using M13 forward and reverse primers in a CEQ 8000 Genetic Analysis System (Beckman-Coulter, Fullerton, CA) according to the manufacturer's instructions.

                    Real-time PCR assay for determination of prophage excision frequencies and the presence of phage particles in culture supernatant

                    The frequency of excision of the four prophages was determined by a SYBR-green-1 dye real time PCR assay using ABI Prism 7000 Sequence Detection System (Applied Biosystems, Inc. Foster city, CA). The real time PCR primers were designed using the ABI software Primer Express and real-time PCR was performed under the following cycling conditions (10 min at 95°C, 45 cycles of 15 s at 95°C, and 1 min at 60°C). Cycle threshold (CT) values were determined by automated threshold analysis with ABI Prism version 1.0 software. The amplification efficiencies were determined by serial dilution and calculated as E = exp-1/m , where E is the amplification efficiency and m is the slope of the dilution curve. Under the conditions of the PCR, the efficiency of the PCR reactions with the various primer pairs was comparable, reaching more than 95%. For determination of the presence of free phage particles, unconcentrated culture supernatants were treated with pancreatic DNase I (Sigma-Aldrich) at 1 mg/ml for 1–3.5 hrs at 37°C and used as template in real time PCR assays using individual primers targeting each prophage.

                    Electron microscopy of culture supernatants

                    B. anthracis Sterne strain, 34F2, was grown in BHI to an OD600 of ~0.2 to 0.4 and induced with mitomycin C (0.5 μg/ml) for 16 hrs. The culture was spun at 8000 rpm for 10 min, the supernatant filtered through 0.45 μm syringe filter (Millex-HV PVDF-Millipore Corp, Medford, MA) and further concentrated 15 × using Amicon Centriplus YM10 (MWCO 10 KDa) filtration units (Millipore Corp, Medford, MA). The concentrated lysate was used for electron microscopic examination. Ten μ1 of each sample was adsorbed onto formvar coated 300-mesh copper grid for 1 minute and excess fluid was wicked away with filter paper. Grids were then washed on 3 droplets of distilled water and stained for 1 minute with 1% of phosphotungstic acid or 1% of uranyl acetate. Grids were examined in a Jeol JEM-1200EX II transmission electron microscope operated at 80 kV. Each grid was scanned for 20 minutes covering more than 70% of the total viewing fields.

                    Declarations

                    Acknowledgements

                    Funding for the project was provided by the U. S. Defense Threat Reduction Agency. We would like to thank CDR Gail Chapman, Drs. Joan Gebhardt, Mark Munson, Stanley Goldman, Richard Calendar and the anonymous reviewers for their many useful comments on improving the manuscript. We would like to thank Dr. Fergus Priest for providing the B. cereus strain collection. We also acknowledge the help of Dr. Mark Munson with sequencing. The electron microscopy work was done at the Core Imaging Facility of the University of Maryland Dental School. The views expressed in this article are those of the authors and do not necessarily reflect the official policy or position of the Department of the Navy, Department of Defense, nor the U.S. Government.

                    Authors’ Affiliations

                    (1)
                    Biological Defense Research Directorate, Naval Medical Research Center
                    (2)
                    The Institute for Genomic Research
                    (3)
                    University of Maryland Medical Biotechnology Center

                    References

                    1. Read TD, Salzberg SL, Pop M, Shumway M, Umayam L, Jiang L, Holtzapple E, Busch JD, Smith KL, Schupp JM, Solomon D, Keim P, Fraser CM: Comparative genome sequencing for discovery of novel polymorphisms in Bacillus anthracis. Science 2002,296(5575):2028–2033.View ArticlePubMed
                    2. Jensen GB, Hansen BM, Eilenberg J, Mahillon J: The hidden lifestyles of Bacillus cereus and relatives. Environ Microbiol 2003,5(8):631–640.View ArticlePubMed
                    3. Keim P, Kalif A, Schupp J, Hill K, Travis SE, Richmond K, Adair DM, Hugh-Jones M, Kuske CR, Jackson P: Molecular evolution and diversity in Bacillus anthracis as detected by amplified fragment length polymorphism markers. J Bacteriol 1997,179(3):818–824.PubMed
                    4. Keim P, Price LB, Klevytska AM, Smith KL, Schupp JM, Okinaka R, Jackson PJ, Hugh-Jones ME: Multiple-locus variable-number tandem repeat analysis reveals genetic relationships within Bacillus anthracis. J Bacteriol 2000,182(10):2928–2936.View ArticlePubMed
                    5. Keim P, Van Ert MN, Pearson T, Vogler AJ, Huynh LY, Wagner DM: Anthrax molecular epidemiology and forensics: using the appropriate marker for different evolutionary scales. Infect Genet Evol 2004,4(3):205–213.View ArticlePubMed
                    6. Yamada S, Ohashi E, Agata N, Venkateswaran K: Cloning and nucleotide sequence analysis of gyrB of Bacillus cereus, B. thuringiensis, B. mycoides, and B. anthracis and their application to the detection of B. cereus in rice. Appl Environ Microbiol 1999,65(4):1483–1490.PubMed
                    7. Bavykin SG, Lysov YP, Zakhariev V, Kelly JJ, Jackman J, Stahl DA, Cherni A: Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to determine phylogenetic relationships of Bacillus cereus group microorganisms. J Clin Microbiol 2004,42(8):3711–3730.View ArticlePubMed
                    8. Harrell LJ, Andersen GL, Wilson KH: Genetic variability of Bacillus anthracis and related species. J Clin Microbiol 1995,33(7):1847–1850.PubMed
                    9. Helgason E, Okstad OA, Caugant DA, Johansen HA, Fouet A, Mock M, Hegna I, Kolsto : Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis - one species on the basis of genetic evidence. Appl Environ Microbiol 2000,66(6):2627–2630.View ArticlePubMed
                    10. Ko KS, Kim JW, Kim JM, Kim W, Chung SI, Kim IJ, Kook YH: Population structure of the Bacillus cereus group as determined by sequence analysis of six housekeeping genes and the plcR Gene. Infect Immun 2004,72(9):5253–5261.View ArticlePubMed
                    11. Price LB, Hugh-Jones M, Jackson PJ, Keim P: Genetic diversity in the protective antigen gene of Bacillus anthracis. J Bacteriol 1999,181(8):2358–2362.PubMed
                    12. Priest FG, Barker M, Baillie LW, Holmes EC, Maiden MC: Population structure and evolution of the Bacillus cereus group. J Bacterial 2004,186(23):7959–7970.View Article
                    13. Hoffmaster AR, Ravel J, Rasko DA, Chapman GD, Chute MD, Marston CK, De BK, Sacchi CT, Fitzgerald C, Mayer LW, Maiden MC, Priest FG, Barker M, Jiang L, Cer RZ, Rilstone J, Peterson SN, Weyant RS, Galloway DR, Read TD, Popovic T, Fraser CM: Identification of anthrax toxin genes in a Bacillus cereus associated with an illness resembling inhalation anthrax. Proc Natl Acad Sci USA 2004,101(22):8449–8454.View ArticlePubMed
                    14. Ivanova N, Sorokin A, Anderson I, Galleron N, Candelon B, Kapatral V, Bhattacharyya A, Reznik G, Mikhailova N, Lapidus A, Chu L, Mazur M, Goltsman E, Larsen N, D'souza M, Walunas T, Grechkin Y, Pusch G, Haselkorn R, Fonstein M, Ehrlich SD, Overbeek R, Kyrpides N: Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature 2003,423(6935):87–91.View ArticlePubMed
                    15. Rasko DA, Altherr MR, Han CS, Ravel J: Genomics of the Bacillus cereus group of organisms. FEMS Microbiol Rev 2005,29(2):303–329.PubMed
                    16. Read TD, Peterson SN, Tourasse N, Baillie LW, Paulsen IT, Nelson KE, Tettelin H, Fouts DE, Eisen JA, Gill SR, Holtzapple EK, Okstad OA, Helgason E, Rilstone J, Wu M, Kolonay JF, Beanan MJ, Dodson RJ, Brinkac LM, Gwinn M, DeBoy RT, Madpu R, Daugherty SC, Durkin AS, Haft DH, Nelson WC, Peterson JD, Pop M, Khouri HM, Radune D, Benton JL, Mahamoud Y, Jiang L, Hance IR, Weidman JF, Berry KJ, Plaut RD, Wolf AM, Watkins KL, Nierman WC, Hazen A, Cline R, Redmond C, Thwaite JE, White O, Salzberg SL, Thomason B, Friedlander AM, Koehler TM, Hanna PC, Kolsto AB, Fraser CM: The genome sequence of Bacillus anthracis Ames and comparison to closely related bacteria. Nature 2003,423(6935):81–86.View ArticlePubMed
                    17. Beres SB, Sylva GL, Sturdevant DE, Granville CN, Liu M, Ricklefs SM, Whitney AR, Parkins LD, Hoe NP, Adams GJ, Low DE, DeLeo FR, McGeer A, Musser JM: Genome-wide molecular dissection of serotype M3 group A Streptococcus strains causing two epidemics of invasive infections. Proc Natl Acad Sci USA 2004,101(32):11833–11838.View ArticlePubMed
                    18. Brussow H, Canchaya C, Hardt WD: Phages and the evolution of bacterial pathogens: from genomic rearrangements to lysogenic conversion. Microbiol Mol Biol Rev 2004,68(3):560–602.View ArticlePubMed
                    19. Waldor MK, Mekalanos JJ: Lysogenic conversion by a filamentous phage encoding cholera toxin. Science 1996,272(5270):1910–1914.View ArticlePubMed
                    20. Lunde M, Blatny JM, Lillehaug D, Aastveit AH, Nes IF: Use of real-time quantitative PCR for the analysis of phiLC3 prophage stability in lactococci. Appl Environ Microbiol 2003,69(1):41–48.View ArticlePubMed
                    21. Nagy E, Ivanovics G: Defective lysogeny in Bacillus anthracis Sterne strains. Acta Microbiol Acad Sci Hung 1972,19(1):69–76.PubMed
                    22. Davison S, Couture-Tosi E, Candela T, Mock M, Fouet A: Identification of the Bacillus anthracis (gamma) phage receptor. J Bacteriol 2005,187(19):6742–6749.View ArticlePubMed
                    23. Buck CA, Anacker RL, Newman FS, Eisenstark A: Phage isolated from lysogenic Bacillus anthracis. J Bacteriol 1963, 85:1423–1430.PubMed
                    24. Los M, Czyz A, Sell E, Wegrzyn A, Neubauer P, Wegrzyn G: Bacteriophage contamination: is there a simple method to reduce its deleterious effects in laboratory cultures and biotechnological factories? J Appl Genet 2004,45(1):111–120.PubMed
                    25. Ko M, Choi H, Park C: Group I self-splicing intron in the recA gene of Bacillus anthracis. J Bacteriol 2002,184(14):3917–3922.View ArticlePubMed
                    26. Kim K, Seo J, Wheeler K, Park C, Kim D, Park S, Kim W, Chung SI, Leighton T: Rapid genotypic detection of Bacillus anthracis and the Bacillus cereus group by multiplex real-time PCR melting curve analysis. FEMS Immunol Med Microbiol 2005,43(2):301–310.View ArticlePubMed
                    27. Oggioni MR, Meacci F, Carattoli A, Ciervo A, Orru G, Cassone A, Pozzi G: Protocol for real-time PCR identification of anthrax spores from nasal swabs after broth enrichment. J Clin Microbiol 2002,40(11):3956–3963.View ArticlePubMed
                    28. Pannucci J, Okinaka RT, Sabin R, Kuske CR: Bacillus anthracis pXOl plasmid sequence conservation among closely related bacterial species. J Bacteriol 2002,184(1):134–141.View ArticlePubMed
                    29. Merrill L, Richardson J, Kuske CR, Dunbar J: Fluorescent heteroduplex assay for monitoring Bacillus anthracis and close relatives in environmental samples. Appl Environ Microbiol 2003,69(6):3317–3326.View ArticlePubMed
                    30. Ko KS, Kim JM, Kim JW, Jung BY, Kim W, Kim IJ, Kook YH: Identification of Bacillus anthracis by rpoB sequence analysis and multiplex PCR. J Clin Microbiol 2003,41(7):2908–2914.View ArticlePubMed
                    31. Qi Y, Patra G, Liang X, Williams LE, Rose S, Redkar RJ, DelVecchio VG: Utilization of the rpoB gene as a specific chromosomal marker for real time PCR detection of Bacillus anthracis. Appl Environ Microbiol 2001,67(8):3720–3727.View ArticlePubMed
                    32. Hurtle W, Bode E, Kulesh DA, Kaplan RS, Garrison J, Bridge D, House M, Frye MS, Loveless B, Norwood D: Detection of the Bacillus anthracis gyrA gene by using a minor groove binder probe. J Clin Microbiol 2004,42(1):179–185.View ArticlePubMed
                    33. Ryu C, Lee K, Yoo C, Seong WK, Oh HB: Sensitive and rapid quantitative detection of anthrax spores isolated from soil samples by real-time PCR. Microbiol Immunol 2003,47(10):693–699.PubMed
                    34. Bode E, Hurtle W, Norwood D: Real-time PCR assay for a unique chromosomal sequence of Bacillus anthracis. J Clin Microbiol 2004,42(12):5825–5831.View ArticlePubMed
                    35. Radnedge L, Agron PG, Hill KK, Jackson PJ, Ticknor LO, Keim P, Andersen GL: Genome differences that distinguish Bacillus anthracis from Bacillus cereus and Bacillus thuringiensis. Appl Environ Microbiol 2003,69(5):2755–2764.View ArticlePubMed
                    36. Ramisse V, Patra G, Garrigue H, Guesdon JL, Mock M: Identification and characterization of Bacillus anthracis by multiplex PCR analysis of sequences on plasmids pXOl and pXO2 and chromosomal DNA. FEMS Microbiol Lett 1996,145(1):9–16.View ArticlePubMed
                    37. Rozen S, Skaletzky HJ: Primer3 on the www for general users and for biologist programmers. Totowa, NJ: Humana Press 2000.

                    Copyright

                    © Sozhamannan et al. 2006

                    This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.