Open Access

Atypical Listeria innocua strains possess an intact LIPI-3

Contributed equally
BMC Microbiology201414:58

DOI: 10.1186/1471-2180-14-58

Received: 1 August 2013

Accepted: 28 February 2014

Published: 8 March 2014

Abstract

Background

Listeria monocytogenes is a food-borne pathogen which is the causative agent of listeriosis and can be divided into three evolutionary lineages I, II and III. While all strains possess the well established virulence factors associated with the Listeria pathogenicity island I (LIPI-1), lineage I strains also possess an additional pathogenicity island designated LIPI-3 which encodes listeriolysin S (LLS), a post-translationally modified cytolytic peptide. Up until now, this pathogenicity island has been identified exclusively in a subset of lineage I isolates of the pathogen Listeria monocytogenes.

Results

In total 64 L. innocua strains were screened for the presence of LIPI-3. Here we report the identification of an intact LIPI-3 in 11 isolates of L. innocua and the remnants of the cluster in several others. Significantly, we can reveal that placing the L. innocua lls genes under the control of a constitutive promoter results in a haemolytic phenotype, confirming that the cluster is capable of encoding a functional haemolysin.

Conclusions

Although the presence of the LIPI-3 gene cluster is confined to lineage I isolates of L. monocytogenes, a corresponding gene cluster or its remnants have been identified in many L. innocua strains.

Background

Listeria monocytogenes is a food-borne pathogen which is the causative agent of listeriosis[15]. It has long been known that the characteristic haemolytic phenotype of L. monocytogenes is attributable to the activity of listeriolysin O (LLO), encoded by the hly gene located within Listeria Pathogenicity Island I (LIPI-1)[5]. However, more recently, it has also been revealed that several strains of lineage I L. monocytogenes (of four evolutionary lineages, serotype 4b strains within lineage I have been most commonly associated with outbreaks[6]) (also possess an additional pathogenicity island (designated LIPI-3) which encodes a second haemolysin, designated listeriolysin S[79]. Listeriolysin S (LLS) is not normally expressed in vitro, and hly mutants give a non-haemolytic phenotype on blood agar. LLS is one of a growing number of post-translationally modified cytolysins (post-translationally modified haemolytic peptides) that include the Streptococcus pyogenes-associated Streptolysin S (SLS) and the Clostridium botulinum/Clostridium sporogenes-associated Clostridiolysin S and is a member of the broader family of thiazole/oxazole modified microcins (TOMMs)[9]. It has been established that LLS plays a role in the survival of L. monocytogenes in PMNs and also contributes to virulence in the murine model[8]. LIPI-3 consists of 8 genes arranged in the following order: llsAGHXBYDP. LlsA is the structural peptide; LlsB, Y and D are enzymes proposed to perform the post-translational modifications; LlsGH is an ABC transporter; LlsP is a protease; while LlsX is of unknown function[7, 8]. The associated promoter, PllsA, which is situated upstream of llsA, is not transcribed in standard laboratory media but is induced by oxidative stress. It has been suggested that expression of the LIPI-3 genes may be induced in the phagosome of macrophages[8]. When PllsA is replaced by a constitutive promoter (PHELP), a strongly haemolytic/cytolytic phenotype is revealed under laboratory conditions[8]. The inducible nature of LLS and its absence in many L. monocyctogenes strains is probably responsible for the fact that this virulence factor has gone undetected until recently.

Listeria innocua is an avirulent species within the Genus Listeria. It has been proposed that L. innocua and L. monocytogenes have evolved from a common ancestor and differ predominantly due to the loss of virulence genes by L. innocua[10, 11]. This is supported by the existence of atypical L. innocua isolates which retain LIPI-1 and other virulence factors[12, 13]. In a previous investigation we demonstrated that none of 11 L. innocua isolates examined (one of which was initially classified as an L. grayi isolate) possessed the equivalent of the LIPI-3[7, 8]. In this study we extended our analysis to a larger collection of strains, which has revealed that several strains possess the remnants of a LIPI-3. In fact, 11 strains possess fully intact LIPI-3 which gives rise to a haemolytic phenotype when the genes are constitutively expressed.

Methods

Strains and growth conditions

Tables 1,2, and3 list the panel of Listeria strains used in this study. Strains were obtained from the Food Microbiology Microbial Collection (University College Cork) and the Special Listeria Culture Collection (SLCC). All strains were cultured at 37°C for 16 h in Brain Heart Infusion (BHI) broth or agar (Oxoid, Hampshire, UK) unless otherwise stated. Where necessary, the characterisation of strains as L. innocua was confirmed biochemically by means of the API listeria kit (BioMérieux, Lyon, France) and 16S ribosomal DNA (rDNA) with CO1 and CO2 primer pairs previously described by Simpson et al.[14]. Escherichia coli EC101 was used as an intermediate vector host. Antibiotics were incorporated as follows[8]: Erythromycin (Ery) 150 μg/ml E. coli, 5 μg/ml L. innocua. Chloroamphenicol (Cm) 10 μg/ml E. coli and L. innocua. Ampicillin (Amp) 100 μg/ml E. coli. 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside (X-Gal) was incorporated at a concentration of 40 μg/ml.
Table 1

LIPI-3 positive SLCC L. monocytogenes strains

UCC strain ID

SLCC strain ID

Lineage*

Logged date

Source

Country of isolation

City of isolation

63

SLCC4352

I

28/04/1975

Human

Spinal fluid

France

Nantes

74

SLCC4563

I

26/11/1975

Human

Unknown

France

Rouen

75

SLCC4330

I

17/03/1975

Human

Spinal fluid

France

Nantes

79

SLCC4309

I

14/02/1975

Human

Liquor

Germany

Munich

86

SLCC3829

I

15/01/1973

Animal

Goat

unknown

Unknown

87

SLCC3734

I

10/11/1972

Food/animal

Milk

Denmark

Copenhagen

89

SLCC4580

I

15/12/1975

Human

Unknown

France

Rouen

94

SLCC3659

I

26/05/1972

Animal

Brain, Sheep

Germany

Frankfurt

101

SLCC6254

I

05/06/1985

Feed

Silage (grass)

Norway

Unknown

102

SLCC6104

I

13/10/1984

Environmental

Sewage

Germany

Unknown

105

SLCC3733

I

10/11/1972

Food/animal

Milk

Denmark

Copenhagen

106

SLCC3606*

I

06/03/1972

Human

Unknown

Belgium

Bruxelles

110

SLCC2503

I

1966

Human

CFS

Germany

Stuttgart

113

SLCC6088

I

13/10/1984

Environmental

Sewage

Germany

Unknown

118

SLCC3834

I

15/01/1973

Animal

Sheep, brain

Germany

Frankfurt

121

SLCC3760

I

24/11/1972

Human

New born, liver

Peru

Lima

133

SLCC6606

I

02/06/1986

Feed

Silage

Switzerland

Unknown

143

SLCC6092

I

13/10/1984

Environmental

Sewage

Germany

Unknown

148

SLCC3732

I

10/11/1972

Food/animal

Milk

Denmark

Copenhagen

154

SLCC3106

I

09/02/1970

Human

Liquor

Germany

Idar-Oberstein

156

SLCC4157

I

09/05/1974

Animal

Cow, Brain

Germany

Freiburg

*Lineages revealed by allele specific oligonucleotide (ASO)-PCR[15].

Table 2

llsA negative L. monocytogenes strains

UCC strain ID

SLCC ID

Lineage*

Logged date

Source

Country of isolation

City of isolation

64

SLCC3996

I

31/08/1973

Human

Spinal fluid

France

Nantes

65

SLCC4410

II

15/07/1975

Human

Blood

France

Nantes

66

SLCC4068

II

08/01/1973

Animal

Red deer, faeces

Germany

Freiburg

67

SLCC6303

II

05/06/1985

Feed

Silage (grass)

Norway

Unknown

68

SLCC6374

II

05/06/1985

Feed

Silage (grass)

Norway

Unknown

69

SLCC6342

II

05/06/1985

Feed

Silage

Norway

Unknown

70

SLCC4274

I

26/11/1974

Human

Unknown

Germany

Freiburg

71

SLCC4280

II

16/12/1974

Unknown

Unknown

Slovak Republic

Bratislava

73

SLCC4063

II

08/01/1974

Animal

Cattle, faeces

Germany

Freiburg

76

SLCC4349

II

28/04/1975

Human

Blood

France

Nantes

77

SLCC4290

II

16/12/1974

Unknown

Unknown

Slovak Republic

Bratislava

78

SLCC4100

II

05/03/1974

Animal

Sheep, brain

Germany

Stuttgart

80

SLCC4481

II

27/10/1975

Unknown

Unknown

Spain

Madrid

81

SLCC4077

II

15/02/1974

Human

Blood

France

Nantes

82

SLCC3852

II

09/04/1973

Animal

Lamb, brain

Germany

Stuttgart

83

SLCC4235

II

16/09/1974

Animal

Hare, caecum

Denmark

Copenhagen

84

SLCC4209

II

12/08/1974

Human

Intestine

Germany

Heidelberg

85

SLCC4230

II

16/09/1974

Animal

Hare, caecum

Denmark

Copenhagen

88

SLCC4592

II

15/12/1975

Human

Unknown

France

Rouen

93

SLCC3738

II

10/11/1972

Animal

Horse

Denmark

Copenhagen

95

SLCC4455

II

10/09/1975

Unknown

Unknown

Hungary

Szolnok

96

SLCC4439

II

10/09/1975

Unknown

Unknown

Hungary

Szolnok

97

SLCC4315

I

14/02/1975

Human

Liquor

Australia

North Adelaide

98

SLCC4234

II

16/09/1974

Animal

Hare, caecum

Denmark

Copenhagen

99

SLCC6108

I

13/10/1984

Environmental

Sewage

Germany

Unknown

100

SLCC643

II

01/01/1958

Human

csf

USA

Georgia

103

SLCC6340

II

05/06/1985

Feed

Silage

Norway

Unknown

104

SLCC293

III

01/01/1955

Unknown

Unknown

USA

Maryland

107

SLCC3631

II

12/04/1972

Animal

Sheep, brain

Germany

Frankfurt

108

SLCC2671

III

01/01/1967

Unknown

Unknown

USA

California

109

SLCC2634

III

1934

Animal

Ruminant

USA

Unknown

111

SLCC6255

II

05/06/1985

Feed

Silage (grass)

Norway

Unknown

112

SLCC6202

II

05/06/1985

Feed

Silage (grass)

Norway

Unknown

114

SLCC6605

II

02/06/1986

Feed

Silage (maize)

Switzerland

Unknown

115

SLCC4138

II

23/04/1974

Animal

Lymph node

Togo

Lome

116

SLCC4617

II

28/12/1975

Unknown

Unknown

Switzerland

Basel

117

SLCC4618

II

28/12/1975

Unknown

Unknown

Switzerland

Basel

119

SLCC4101

II

05/03/1974

Animal

Sheep, brain

Germany

Stuttgart

120

SLCC4070

II

08/01/1974

Animal

Cattle, faeces

Germany

Freiburg

123

SLCC3939

II

09/07/1973

Human

Blood

Belgium

Bruxelles

125

SLCC3847

II

09/04/1973

Animal

Fox, brain

Slovenia

Ljubljana

125

SLCC3864

II

09/04/1973

Animal

Calf, organs

Germany

Freiburg

126

SLCC4079

II

15/02/1974

Human

Meconium

France

Nantes

127

SLCC4294

II

16/12/1974

Unknown

Unknown

Slovak Republic

Bratislava

128

SLCC4442

II

10/09/1975

Unknown

Unknown

Hungary

Szolnok

129

SLCC4444

II

10/09/1975

Unknown

Unknown

Hungary

Szolnok

130

SLCC3278

I

03/09/1970

Animal

Duck, liver

Denmark

Copenhagen

131

SLCC3270

II

03/09/1970

Animal

Hare, pus

Denmark

Copenhagen

132

SLCC3258

II

02/09/1970

Unknown

Unknown

Belgium

Bruxelles

135

SLCC5203

II

17/11/1977

Feed

Silage

Netherlands

Unknown

136

SLCC3683

II

22/06/1972

Environmental

Fir needle

Germany

Unknown

137

SLCC6611

II

02/06/1986

Environmental

Soil

Switzerland

Unknown

138

SLCC4153

I

09/05/1974

Animal

Faeces

Germany

Freiburg

139

SLCC3269

II

03/09/1970

Animal

Hare, spleen

Denmark

Copenhagen

141

SLCC3214

II

18/06/1970

Human

Spinal fluid

France

Lyon

144

SLCC6343

II

05/06/1985

Feed

Silage

Unknown

Unknown

146

SLCC3629

I

04/04/1972

Human

New born; intestine, liver

Peru

Lima

147

SLCC3569

II

08/02/1972

Animal

Hen

France

Alfort

149

SLCC3458

I

08/07/1971

Human

Unknown

France

Rouen

150

SLCC3457

II

08/07/1971

Human

Unknown

France

Rouen

152

SLCC3366

I

11/03/1971

Animal

Pig, brain

Germany

Freiburg

153

SLCC3277

II

03/09/1970

Animal

Bird, liver

Denmark

Copenhagen

*Lineages revealed by allele specific oligonucleotide (ASO)-PCR[15].

Table 3

Listeria innocua strains used in this study

UCC strain ID

SLCC strain ID

Serotype

Logged date

Source

Country of isolation

City of isolation

llsA PCR

LIPI-3 PCR

1

SLCC7157*

6a

08/12/1986

Animal

Roe

Switzerland

Bern

2

SLCC7199

6b

18/12/1986

Food

Cheese

Germany

Munich

3

SLCC6483

6b

05/03/1986

Food

Cheese

Switzerland

St.Gallen

4

SLCC6109

6a

13/10/1984

Sewage

Sewage

Germany

Braunschweig

5

SLCC6814

4c

07/05/1986

Human

Liquor (meningitis)

UK

London

6

SLCC6270

6b

05/06/1985

Animal

Goat

Norway

Minde

7

SLCC6276

6b

05/06/1985

Animal

Sheep

Norway

Minde

8

SLCC6362

6b

05/06/1985

Animal

Sheep

Norway

Minde

9

SLCC6370*

6b

05/06/1985

Animal

Sheep

Norway

Minde

10

SLCC6382

6b

05/06/1985

Animal

Sheep

Norway

Minde

11

SLCC6285*

6b

05/06/1985

Feed

Silage (grass)

Norway

Minde

12

SLCC6373

6b

05/06/1985

Feed

Silage (grass)

Norway

Minde

13

SLCC6098

6a

13/10/1984

Sewage

Sewage

Germany

Braunschweig

14

SLCC6007

6a

10/08/1984

  

Brasil

Rio de Janeiro

15

SLCC6099

6a

13/10/1984

Sewage

Sewage

Germany

Braunschweig

16

SLCC6364

6b

05/06/1985

Animal

Sheep

Norway

Minde

17

SLCC6317*

6b

05/06/1985

Animal

Sheep

Norway

Minde

18

SLCC7030

6a

14/11/1986

Food

Cheese

Germany

Munich

19

SLCC6297*

6b

05/06/1985

Feed

Silage (grass)

Norway

Minde

20

SLCC6356

6b

05/06/1985

Food/animal

Milk

Norway

Minde

21

SLCC6235

6b

05/06/1985

Silage (grass)

Silage (grass)

Norway

Minde

22

SLCC6298

6b

05/06/1985

Feed

Silage (grass)

Norway

Minde

23

SLCC6203

6b

05/06/1985

Silage (grass)

Silage (grass)

Norway

Minde

24

SLCC7116

6a

17/11/1986

Food

Cheese

Austria

Innsbruck

25

SLCC6353

6b

05/06/1985

Food/animal

Milk

Norway

Minde

26

SLCC6409

6b

05/06/1985

Feed

Silage (grass)

Norway

Minde

28

SLCC6541

6a

23/04/1986

Food

Cheese

Germany

Munich

29

SLCC6927

6b

22/09/1986

  

Austria

Vienna

31

SLCC6228

6b

05/06/1985

Silage (grass)

Silage (grass)

Norway

Minde

30

SLCC6749

6b

31/07/1986

Food

Cheese

Germany

Munich

32

SLCC6322

6a

05/06/1985

Feed

Silage (grass)

Norway

Minde

33

SLCC5916

6a

16/03/1984

  

Switzerland

Lausanne

34

SLCC5326

6a

09/03/1979

  

USA

Richmond, Virginia

35

SLCC6283

6b

05/06/1985

Feed

Silage (grass)

Norway

Minde

36

SLCC6246

6b

05/06/1985

Feed

Silage (grass)

Norway

Minde

37

SLCC3533

4b

06/12/2010

Environment

Leaves

Germany

Freiburg

38

SLCC6466

6b

30/01/1986

Food

Cheese

Switzerland

St.Gallen

39

SLCC6359

6b

05/06/1985

Animal

Goat

Norway

Minde

40

SLCC6286

6b

05/06/1985

Feed

Silage (grass)

Norway

Minde

41

SLCC6294

6b

05/06/1985

Animal

Sheep

Norway

Minde

42

SLCC6371

6b

05/06/1985

Animal

Sheep

Norway

Minde

43

SLCC6119

6a

10/12/1984

Human

 

Germany

Goettingen

44

SLCC3947

4f

27/07/1973

Human

 

Germany

Cologne

45

SLCC6519

6a

23/03/1986

Food

Cheese

Germany

Munich

46

SLCC6408*

6b

05/06/1985

Feed

Silage (grass)

Norway

Minde

47

SLCC6296

6b

05/06/1985

Feed

Silage (grass)

Norway

Minde

48

SLCC5328

6b

09/03/1979

  

USA

Richmond, Virginia

49

SLCC6279

6b

05/06/1985

Animal

Sheep

Norway

Minde

50

SLCC6318

6b

05/06/1985

Animal

Sheep

Norway

Minde

51

SLCC6542

6a

23/04/1986

Food

Cheese

Germany

Munich

52

SLCC6272

6b

05/06/1985

Animal

Goat

Norway

Minde

53

SLCC3835*

6b

08/02/1973

Human

 

Germany

Cologne

54

SLCC5998

6b

16/07/1984

Animal

Cattle

Belgium

Bruxelles

55

SLCC6670

6a

02/06/1986

Food

Milk

Switzerland

Bern

56

SLCC6667

6a

02/06/1986

Food

Milk

Switzerland

Bern

57

SLCC5753*

6b

16/11/1982

  

Slovak Republic

Bratislava

58

SLCC7113

6b

17/11/1986

Food

Cheese

Austria

Vienna

59

SLCC6103

6b

13/10/1984

Sewage

Sewage

Germany

Braunschweig

60

SLCC6543

6a

23/04/1986

Food

Cheese

Germany

Munich

61

SLCC6977*

4c

13/10/1986

Food

Cheese

Germany

Munich

62

SLCC6921

6a

22/09/1986

Food

Milk

Switzerland

Bern

FH2034

N/A

Unknown

2000

Food

Raw mince

Ireland

Cork

FH1836

N/A

Unknown

2000

Food

Spinach cannelloni

Ireland

Cork

FH2051

N/A

Unknown

2000

Food

Chicken nuggets

Ireland

Cork

*Possess llsA but not other LIPI-3 associated genes.

Sequence analysis

A PCR-based strategy, employing the primer pair llsA For-llsA Rev, was employed to screen for the presence of the LLS structural gene, llsA. These and other primers corresponding to regions both within (1113for, 1114rev, 1115 rev, 1118rev, 1120rev) and surrounding (araC rev) the LIPI-3 of L. monocytogenes F2365 were employed to amplify flanking DNA sequences which were subsequently sequenced (MWG Biotech) (Table 4). Primer Lin1080_F1, which was designed to amplify from the conserved gene, corresponding to lin1080 in strain CLIP11262, was used to determine the position of LIPI-3 in L. innocua strains relative to this locus. Overlapping sequences were assembled and a consensus sequence was determined using the Seqmanager programme (Lasergene 6) and deposited in Genbank (accession numbers KJ394487, KJ394488, KJ394489 and KJ394490). Putative open reading frames (ORFs) were identified and pair-wise alignment of protein sequences was carried out using Needlemann-Wunsch global alignment algorithms accessed via the European Bioinformatics Institute (EBI) web server. Shading of multiple-aligned sequences was carried out using the Boxshade programme (version 3.2) accessed via the European Molecular Biology web server (EMBnet).
Table 4

Primers used in this study

Primer name

Sequence (5′ to 3′)*

PllsAchgA(LI)

GGCTGCAG AATCCGCGTTCTTG

PllsAchgB(LI)

GAGGTTTTAGGGCTTTGCTC

PhelpFsoe(LI)

GAGCAAAGCCCTAAAACCTC GAGATCTGCTGG

PhelpRsoe

GATGATTGTGATTTAATATTCAT GGGTTTCACTCTC

PllsAchgC

ATGAATATTAAATCACAATCATC

PllsAchgD

TGGAATTC CCAGCTCCATTGTCTC

pORI280For

CTCGTTCATTATAACCCTC

pORI280Rev

CGCTTCCTTTCCCCCCAT

Lin1080_F1

CGGTACGGATTGTGAATGAAGTGG

llsA For

CGATTTCACAATGTGATAGGATG

llsA Rev

GCACATGCACCTCATAAC

1113for

GTTATGAGGTGCATGTGC

1114rev

GTCTGGGATATGTAGTCC

1115 rev

CACTAGCATGATGTTTATAGGGG

1118rev

CATGACAAGCAGTGCCTGTTGATACAGC

1120rev

CGTTCCCCCTCCTTTTTAGAGCAG

araC rev

CTCTCCTTTTCATTAGCCTGC

actA1-f

AATAACAACAGTGAACAAAGC

actA1-r

TATCACGTACCCATTTACC

plcB2-f

TTGTGATGAATACTTACAAAC

plcB2-r

TTTGCTACCATGTCTTCC

actA3-f

CGGCGAACCATACAACAT

plcB3-r

TGTGGTAATTTGCTGTCG

*Restriction site in bold and SOE overhang italicised.

Constitutive expression of the LIPI-3 cluster of L. innocua strain FH2051

The L. innocua FH2051 lls genes were placed under the control of the strong constitutive synthetic promoter PHELP using the pORI-based repA-negative plasmid system as previously described by Cotter et al., with some modification[8]. Briefly, PHELP DNA was amplified with the primer pair PhelpFsoe(LI)/PhelpRsoe from the plasmid pPL2luxPHelp[16] and fused between two DNA fragments amplified from the regions flanking P llsA by splicing by overlap extension (SOE) PCR[17]. The upstream region was amplified with the primer pair PllsAchgA(LI) and PllsAchgB(LI) and the downstream region was amplified with primers PllsAchgC and PllsAchgD. All PCRs were performed using Vent DNA polymerase (NEB, New England Biolabs, MA, USA). The SOE PCR product was cloned into the multiple cloning site (MCS) of pORI280 following PstI and EcoRI (NEB) digestion and ligation with the Ligafast rapid DNA ligation system (Promega, Madison, USA). The sequence of the cloned product was verified with MCS primers pORI280For/Rev by MWG Biotech, Germany[18]. Pellet-paint (Novagen) precipitated plasmid was subsequently transformed into the intermediate repA-positive host E. coli EC101. The plasmid was co-transformed into L. innocua FH2051 with the highly temperature-sensitive plasmid pVE6007 which supplies RepA in trans. Transformed cells appeared as blue colonies following plating on BHI-Ery-Xgal at 30°C. The integration of pORI280 by single crossover homologous recombination was stimulated by picking a single blue colony from the transformation plate and incubating it on BHI-Ery-Xgal at 30°C for 24 h and subcultured twice on BHI-Ery-Xgal at 42°C. A second crossover event, resulting in the introduction of PHELP in place of PllsA and the eventual loss of the pORI280 vector, was screened for following multiple subcultures in the absence of antibiotic selection. The introduction of PHELP upstream of llsA in Ery resistant Cm sensitive colonies was confirmed by PCR. A haemolytic phenotype was determined by spotting 10 μL of an overnight culture of this strain onto Columbia blood agar (Oxoid) containing 5% defibrinated horse blood (TCS Biosciences, Buckingham, UK) and 1 mU/ml sphingomyelinase (Sigma) and examining after 24 h.

Pulsed- field gel electrophoresis

Pulsed-field gel electrophoresis was carried out following the CDC standardized PulseNet protocol for L. monocytogenes with Asc I and Apa I as the restriction endonucleases. The PFGE patterns were analyzed using BioNumerics software[19].

Results and discussion

Screening L. monocytogenes and L. innocua for homologues of llsA

To date LIPI-3 has been identified in ~60% (27 of 46) of lineage I L. monocytogenes but was absent from all lineage II (n = 23) and lineage III (n = 5) isolates tested[8]. As a consequence of gaining access to the Seeliger collection of Listeria isolates[20], we were provided with the opportunity to screen for the presence of LIPI-3 among an additional 83 L. monocytogenes isolates including 30 lineage I, 50 lineage II and 3 lineage III strains. The llsA gene was not identified in any lineage II or lineage III strain, consistent with our previous observations (Table 1). However, the llsA gene was identified in 70% of lineage I L. monocytogenes screened (21 of 30) and, on the basis of PCR amplification, in all cases the full complement of LIPI-3 genes was present. All such isolates originated from human, animal (including milk and feed) and sewage sources. When collated with data from previous studies, it is apparent that 63% (48 of 76) of lineage I isolates are LIPI-3 positive and may be capable of LLS production. All LIPI-3 positive isolates belonged to Lineage I as verified by an allele specific oligonucleotide PCR multiplex (actA1-f, actA1-r, plcB2-f, plcB2-r, actA3-f, plcB3-r) based on the prfA virulence gene cluster[15], thus verifying previous observations with respect to the distribution of LIPI-3 among different evolutionary lineages of L. monocytogenes[7, 8].

Access to the Seeliger collection and other strains also facilitated a further investigation of the LIPI-3 status of L. innocua. As stated, a previous analysis of 11 strains of L. innocua indicated that all lacked genes associated with LIPI-3[7, 8]. However, screening a larger collection of 64 L. innocua strains using llsA specific primers revealed that 45 strains (70.3%) were llsA-positive (Table 3). Further PCR-based analysis of these isolates, employing a variety of primers designed to amplify across and within the LIPI-3 (llsA For, llsA Rev, 1113for, 1114rev, 1115rev, 1118rev, 1120rev, araC rev) revealed that 11 of these strains possess a cluster which is comparable in size, gene content and gene organisation to that of the LIPI-3 cluster found in a subset of lineage I L. monocytogenes strains. These 11 isolates originated from a number of European countries between 1984 and 2000, and were isolated from varied sources including processed chicken[1], cheese[7], sheep[7], silage[7] and human[1] (Table 3). Further analysis revealed that 25 L. innocua isolates possess a truncated LIPI-3 with no PCR product generated for llsBYDP. Sequencing the region confirmed that these genes are absent in at least two isolates (SLCC6270 and SLCC6382). With the exception of llsP, these genes have previously been found to be essential for LLS production in L. monocytogenes[7]. Of the remaining 28 strains, 9 were found to contain llsA but attempts to amplify across or within other LIPI-3 associated genes were unsuccessful and another 19 isolates lacked all LIPI-3 genes.

Two L. innocua isolates, SLCC6382 and SLCC6270, containing a truncated LIPI-3, were selected for further analysis. Both SLCC6382 and SLCC6270 shared 98% homology with respect to the structural peptide LlsA. The putative LlsG, LlsH and LlsX proteins from both strains shared 96%, 99% and 95% identity with their L. monocytogenes counterpart. llsB, llsY, llsD and llsP are absent from both isolates, while the AraC-like regulatory protein determinant was present with 98% identity to the L. monocytogenes cluster. As in L. monocytogenes, the L. innocua cluster is located downstream of a putative glutamine hydrolyzing GMP synthase protein (GuaA). However, the island in SLCC6382 and SLCC6270 commences 600 bases immediately downstream of guaA and thus is not flanked by glyoxylase encoding genes, thereby contrasting with LIPI-3 in L. monocytogenes.

Three strains (SLCC6466, SLCC6294, FH2051) possessing an entire LIPI-3 cluster were also selected for a more extensive investigation. Eight complete ORFs were identified, each corresponding to their homologue in the L. monocytogenes LIPI-3 cluster (llsAGHXBYDP). Sequence alignments confirmed considerable homology at the protein level (Figure 1). The structural peptide LlsA shared 98% homology in the case of the three strains mentioned above to the L. monocytogenes equivalent. These L. innocua clusters also encode homologs of the putative two component ABC transport system LlsG and LlsH, with LlsG sharing 95.3% (FH2051) and 95% (SLCC6466, SLCC6294) identity, and 98.8% (FH2051) and 99% (SLCC6466, SLCC6294) with respect to LlsH. The putative LlsX homolog, which is of unknown function, is 97% identical to its L. monocytogenes counterpart for all three isolates. This gene is believed to be specific to LIPI-3 since no homologue exists among other sag-like gene clusters[7]. A corresponding cluster of putative Lls homologs, all of which are predicted to encode biosynthetic enzymes, were also identified[8]; LlsB (99% in the case of all three strains), LlsY (95.4% FH2051, 95% SLCC6466 and SLCC6294) and LlsD (98.4% FH2051, 98% SLCC6466 and SLCC6294). Finally, the L. innocua cluster also carries putative LlsP and Lmof2365_1120 homologs, annotated as a CAAX amino-terminal putative metalloprotease and AraC-like regulatory protein which share 93.8% FH2051, 91% SLCC6466 and SLCC6294 and 91.3% FH2051, 94% SLCC6466 and SLCC6294 identity to the L. monocytogenes cluster, respectively. PFGE was carried out to assess the relatedness of the 11 L. innocua strains harbouring intact LIPI-3 a s. On the basis of this analysis, all LIPI-3+ isolates share a high degree of similarity, with the majority of strains (SLCC6466, SLCC6814, SLCC6749, SLCC6276, SLCC6279, SLCC6294, FH2051, SLCC6296 and SLCC6298) displaying 80% similarity and strains SLCC6203 and SLCC7199 sharing 76% identity (Figure 2).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2180-14-58/MediaObjects/12866_2013_Article_2224_Fig1_HTML.jpg
Figure 1

Alignments of the structural ( llsA ) genes of LIPI-3 mono (F2365) and LIPI-3 innoc (FH2051, SLCC6466, SLCC6294, SLCC6270 and SLCC6382) .

https://static-content.springer.com/image/art%3A10.1186%2F1471-2180-14-58/MediaObjects/12866_2013_Article_2224_Fig2_HTML.jpg
Figure 2

Dendrograms derived from PFGE profiles of Asc I and Apaf I macrorestriction displaying restriction pattern similarity among the 11L. innocua LIPI-3 + isolates.

The LIPI-3+ L. innocua FH2051 is non-haemolytic when grown on Columbia blood agar (Figure 1). This is not surprising given that L. innocua strains do not produce LLO and the fact that it has previously been established that LLS is not produced by wild type L. monocytogenes in laboratory media. It has been established that the latter is due to the fact that P llsA is not transcribed under standard laboratory conditions[8]. It has been noted previously that P llsA is induced under oxidative stress but, unfortunately, the requirement for an oxidizing agent prevents an assessment of associated haemolytic activity on blood agar[7]. Thus, to investigate the functionality of the LIPI-3 cluster in L. innocua, here we constitutively expressed LIPI-3 through the introduction of the constitutive Highly Expressed Listeria Promoter [PHELP, (LLSC)] upstream of llsA in L. innocua FH2051, to create FH2051LLSC. Examination of the resultant strain revealed that the L. innocua LIPI-3 is indeed functional as evidenced by a clear haemolytic phenotype on Columbia blood agar (Figure 3).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2180-14-58/MediaObjects/12866_2013_Article_2224_Fig3_HTML.jpg
Figure 3

Growth, after 24 h at 37°C, of L. innocua FH2051 and FH2051LLS C (10 μL spots of an overnight cultures) on Columbia blood agar containing 5% defibrinated horse blood and 1 mU/ml sphingomyelinase.

Conclusion

In conclusion, we have established that although the presence of the LIPI-3 gene cluster is confined to lineage I isolates of L. monocytogenes, a corresponding gene cluster or its remnants can be identified in many L. innocua. It is now generally accepted that L. innocua and L. monocytogenes evolved from a common ancestor, with L. innocua having lost virulence genes since this division. Although rare, L. innocua isolates exist which possess the LIPI-1 gene cluster and another L. monocytogenes associated virulence gene, inlA[12, 13]. Nonetheless, the retention of the LIPI-3 cluster by a large proportion of strains is unexpected. The LIPI-3 clusters in the various L. innocua strains seem to be at various stages of reductive evolution with a number of stains possessing an intact island, others showing clear evidence of disintegration and yet another group in which the island is completely absent. It is not clear, however, whether the gradual loss of LIPI-3 from L. innocua strains is a slow process that has been underway since the existence of the last common ancestor of L. monocytogenes and L. innocua or if it was initiated following a more recent acquisition of LIPI-3 by L. innocua from L. monocytogenes.

Notes

Declarations

Acknowledgements

The authors would like to thank Jana Haase and Mark Achtman for providing strains and Avelino Alvarez Ordonez and Dara Leong for technical assistance with PFGE. This work was funded by the Enterprise Ireland Commercialisation fund, a programme which is co-financed by the EU through the ERDF. This work was also supported by the Irish Government under the National Development Plan, through Science Foundation Ireland Investigator awards; (06/IN.1/B98) and (10/IN.1/B3027).

Authors’ Affiliations

(1)
Department of Microbiology, University College Cork
(2)
Alimentary Pharmabiotic Centre
(3)
Teagasc, Moorepark Food Research Centre

References

  1. Berche P: Pathophysiology and epidemiology of listeriosis. Bull Acad Natl Med. 2005, 189: 507-516. discussion 516–21PubMedGoogle Scholar
  2. Hamon M, Bierne H, Cossart P: Listeria monocytogenes: a multifaceted model. Nat Rev Microbiol. 2006, 4: 423-434. 10.1038/nrmicro1413.View ArticlePubMedGoogle Scholar
  3. Jackson KA, Iwamoto M, Swerdlow D: Pregnancy-associated listeriosis. Epidemiol Infect. 2010, 138: 1503-1509. 10.1017/S0950268810000294.View ArticlePubMedGoogle Scholar
  4. Roberts AJ, Wiedmann M: Pathogen, host and environmental factors contributing to the pathogenesis of listeriosis. Cell Mol Life Sci. 2003, 60: 904-918.PubMedGoogle Scholar
  5. Vazquez-Boland JA, Kuhn M, Berche P, Chakraborty T, Dominguez-Bernal G, Goebel W, Gonzalez-Zorn B, Wehland J, Kreft J: Listeria pathogenesis and molecular virulence determinants. Clin Microbiol Rev. 2001, 14: 584-640. 10.1128/CMR.14.3.584-640.2001.PubMed CentralView ArticlePubMedGoogle Scholar
  6. Orsi RH, den Bakker HC, Wiedmann M: Listeria monocytogenes lineages: genomics, evolution, ecology, and phenotypic characteristics. Int J Med Microbiol. 2011, 301: 79-96. 10.1016/j.ijmm.2010.05.002.View ArticlePubMedGoogle Scholar
  7. Clayton EM, Hill C, Cotter PD, Ross RP: Real-time PCR assay to differentiate listeriolysin S-positive and -negative strains of Listeria monocytogenes. Appl Environ Microbiol. 2011, 77: 163-171. 10.1128/AEM.01673-10.PubMed CentralView ArticlePubMedGoogle Scholar
  8. Cotter PD, Draper LA, Lawton EM, Daly KM, Groeger DS, Casey PG, Ross RP, Hill C: Listeriolysin S, a novel peptide haemolysin associated with a subset of lineage I Listeria monocytogenes. PLoS Pathog. 2008, 4: e1000144-10.1371/journal.ppat.1000144.PubMed CentralView ArticlePubMedGoogle Scholar
  9. Molloy EM, Cotter PD, Hill C, Mitchell DA, Ross RP: Streptolysin S-like virulence factors: the continuing sagA. Nature reviews. Microbiology. 2011, 9: 670-681.PubMed CentralPubMedGoogle Scholar
  10. den Bakker HC, Bundrant BN, Fortes ED, Orsi RH, Wiedmann M: A population genetics-based and phylogenetic approach to understanding the evolution of virulence in the genus Listeria. Appl Environ Microbiol. 2010, 76: 6085-6100. 10.1128/AEM.00447-10.PubMed CentralView ArticlePubMedGoogle Scholar
  11. den Bakker HC, Cummings CA, Ferreira V, Vatta P, Orsi RH, Degoricija L, Barker M, Petrauskene O, Furtado MR, Wiedmann M: Comparative genomics of the bacterial genus Listeria: genome evolution is characterized by limited gene acquisition and limited gene loss. BMC Genomics. 2010, 11: 688-10.1186/1471-2164-11-688.PubMed CentralView ArticlePubMedGoogle Scholar
  12. Johnson J, Jinneman K, Stelma G, Smith BG, Lye D, Messer J, Ulaszek J, Evsen L, Gendel S, Bennett RW, Swaminathan B, Pruckler J, Steigerwalt A, Kathariou S, Yildirim S, Volokhov D, Rasooly A, Chizhikov V, Wiedmann M, Fortes E, Duvall RE, Hitchins AD: Natural atypical Listeria innocua strains with Listeria monocytogenes pathogenicity island 1 genes. Appl Environ Microbiol. 2004, 70: 4256-4266. 10.1128/AEM.70.7.4256-4266.2004.PubMed CentralView ArticlePubMedGoogle Scholar
  13. Volokhov DV, Duperrier S, Neverov AA, George J, Buchrieser C, Hitchins AD: The presence of the internalin gene in natural atypically haemolytic Listeria innocua strains suggests descent from L. monocytogenes. Appl Environ Microbiol. 2007, 73: 1928-1939. 10.1128/AEM.01796-06.PubMed CentralView ArticlePubMedGoogle Scholar
  14. Simpson PJ, Stanton C, Fitzgerald GF, Ross RP: Genomic diversity and relatedness of bifidobacteria isolated from a porcine cecum. J Bacteriol. 2003, 185: 2571-2581. 10.1128/JB.185.8.2571-2581.2003.PubMed CentralView ArticlePubMedGoogle Scholar
  15. Ward TJ, Gorski L, Borucki MK, Mandrell RE, Hutchins J, Pupedis K: Intraspecific phylogeny and lineage group identification based on the prfA virulence gene cluster of Listeria monocytogenes. J Bacteriol. 2004, 186: 4994-5002. 10.1128/JB.186.15.4994-5002.2004.PubMed CentralView ArticlePubMedGoogle Scholar
  16. Riedel CU, Monk IR, Casey PG, Morrissey D, O’Sullivan GC, Tangney M, Hill C, Gahan CG: Improved luciferase tagging system for Listeria monocytogenes allows real-time monitoring in vivo and in vitro. Appl Environ Microbiol. 2007, 73: 3091-3094. 10.1128/AEM.02940-06.PubMed CentralView ArticlePubMedGoogle Scholar
  17. Horton RM, Cai ZL, Ho SN, Pease LR: Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. Biotechniques. 1990, 8: 528-535.PubMedGoogle Scholar
  18. Monk IR, Gahan CG, Hill C: Tools for functional postgenomic analysis of listeria monocytogenes. Appl Environ Microbiol. 2008, 74: 3921-3934. 10.1128/AEM.00314-08.PubMed CentralView ArticlePubMedGoogle Scholar
  19. Graves ML, Swaminathan B: PulseNet standardized protocol for subtyping Listeria monocytogenes by macrorestriction and pulsed-field gel electrophoresis. Int J Food Microbiol. 2001, 65: 55-62. 10.1016/S0168-1605(00)00501-8.View ArticlePubMedGoogle Scholar
  20. Haase JK, Murphy RA, Choudhury KR, Achtman M: Revival of Seeliger’s historical ‘special Listeria culture Collection’. Environ Microbiol. 2011, 13: 3163-10.1111/j.1462-2920.2011.02610.x.View ArticlePubMedGoogle Scholar

Copyright

© Clayton et al.; licensee BioMed Central Ltd. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited.