Open Access

CRISPR-MVLST subtyping of Salmonella enterica subsp. entericaserovars Typhimurium and Heidelberg and application in identifying outbreak isolates

  • Nikki Shariat1,
  • Carol H Sandt2,
  • Michael J DiMarzio1,
  • Rodolphe Barrangou1, 3 and
  • Edward G Dudley1Email author
BMC Microbiology201313:254

DOI: 10.1186/1471-2180-13-254

Received: 10 March 2013

Accepted: 4 November 2013

Published: 12 November 2013

Abstract

Background

Salmonella enterica subsp. enterica serovars Typhimurium (S. Typhimurium) and Heidelberg (S. Heidelberg) are major causes of foodborne salmonellosis, accounting for a fifth of all annual salmonellosis cases in the United States. Rapid, efficient and accurate methods for identification are required for routine surveillance and to track specific strains during outbreaks. We used Pulsed-field Gel Electrophoresis (PFGE) and a recently developed molecular subtyping approach termed CRISPR-MVLST that exploits the hypervariable nature of virulence genes and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) to subtype clinical S. Typhimurium and S. Heidelberg isolates.

Results

We analyzed a broad set of 175 S. Heidelberg and S. Typhimurium isolates collected over a five-year period. We identified 21 Heidelberg Sequence Types (HSTs) and 37 Typhimurium STs (TSTs) that were represented by 27 and 45 PFGE pulsotypes, respectively, and determined the discriminatory power of each method.

Conclusions

For S. Heidelberg, our data shows that combined typing by both CRISPR-MVLST and PFGE provided a discriminatory power of 0.9213. Importantly, CRISPR-MVLST was able to separate common PFGE patterns such as JF6X01.0022 into distinct STs, thus providing significantly greater discriminatory power. Conversely, we show that subtyping by either CRISPR-MVLST or PFGE independently provides a sufficient discriminatory power (0.9345 and 0.9456, respectively) for S. Typhimurium. Additionally, using isolates from two S. Typhimurium outbreaks, we demonstrate that CRISPR-MVLST provides excellent epidemiologic concordance.

Keywords

CRISPR subtyping CRISPR-MVLST Molecular subtyping Salmonella Heidelberg Salmonella Typhimurium

Background

Non-typhoidal Salmonella are one of the leading causes of bacterial foodborne disease in the United States, accounting for over a million human cases each year [1]. Salmonellosis symptoms include diarrhea, fever and abdominal cramps that occur 12 to 72 hours after infection. Annually, Salmonella is responsible for an estimated 20,000 hospitalizations and nearly 400 deaths in the United States, with a financial burden of approximately $3.3 – 4.4 billion [2, 3]. Most infections are transmitted via ingestion of contaminated food and, unlike trends with other bacterial foodborne pathogens, the annual incidence rate of salmonellosis has not significantly declined over the past decade. Since 2006, nearly a fifth of all salmonellosis cases in the United States were caused by Salmonella enterica subsp. enterica serovars Typhimurium (S. Typhimurium) and Heidelberg (S. Heidelberg) [4]. According to the Centers for Disease Control and Prevention, there have already been two outbreaks in 2013 where S. Typhimurium and S. Heidelberg were responsible [5, 6].

To limit and reduce the scope of a Salmonella outbreak, an efficient and robust surveillance system is vital. During epidemiological investigations Salmonella isolates are serotyped and concurrently subtyped to classify isolates to the strain level. An ideal subtyping method has a high discriminatory power (i.e. can separate all unrelated strains) but is not so discriminatory that it inadvertently separates isolates that are part of the same outbreak (i.e. possesses high epidemiologic concordance). There are several molecular-based subtyping approaches that have been developed, including pulsed-field gel electrophoresis (PFGE) [7], amplified fragment length polymorphism (AFLP) [810], multiple-locus variable-number tandem-repeat analysis (MLVA) [1117], multiple amplification of prophage locus typing (MAPLT) [13, 18] and, most recently, a multiplex DNA suspension array [19]. PFGE was adapted to Salmonella in the 1990s and generally provides a high discriminatory power for subtyping most Salmonella serovars, though it certainly does not provide equal sensitivity across all serovars [20]. Despite being labor-intensive and time-consuming, conventional serotyping and concurrent PFGE fingerprinting is still considered the gold standard for Salmonella subtyping and is widely used by public health surveillance laboratories [2123]. Although PFGE data are uploaded to PulseNet USA (http://www.cdc.gov/pulsenet), the national electronic network for food disease surveillance that is coordinated by the CDC, inter-laboratory comparisons of PFGE fingerprints can be ambiguous.

There are several different PFGE patterns, or pulsotypes, though most often a limited number of common patterns are associated with the majority of isolates within a given serovar. Two recent S. Typhimurium and S. Heidelberg foodborne outbreaks in the United States involved contaminated cantaloupe melons (S. Typhimurium, 2012; 228 reported illnesses) [24] and broiled chicken livers (S. Heidelberg, 2011; 190 reported illnesses) [25]. In both cases, the individual XbaI PFGE patterns associated with each strain were fairly common: for S. Typhimurium, the associated PFGE pattern is typically seen in 10–15 cases per month [24] and for S. Heidelberg, the pattern occurs even more frequently, 30–40 cases per month [25]. Consequently, identification of the outbreak strains was particularly difficult and to more accurately identify isolates that were part of the S. Typhimurium cantaloupe outbreak, these isolates were also analyzed by MVLA to define the outbreak strain. Additionally, another S. Heidelberg outbreak in 2011, linked to ground turkey, involved isolates with two similar but distinctly different PFGE patterns, thus showing reduced epidemiologic concordance by this subtyping method [26]. This last example may indicate evolutionary relatedness between the two sets of isolates which, unlike some methods, PFGE cannot really provide.

The recent outbreak cases described above highlight the need for additional subtyping approaches for Salmonella that can be used instead of, or as a complement to PFGE for routine disease surveillance and outbreak tracking. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) are found in ~50% of all bacterial species, including Salmonella[27]. CRISPR elements comprise several unique short sequences, called spacers, which are interspaced by conserved direct repeats. In some bacteria, homology between a spacer and a complementary target nucleic acid results in degradation of the target by sequence-specific endonucleases, providing protection from exogenous bacteriophage or plasmid DNA [reviewed in [28]. Due to both acquisition and loss of these spacer elements, CRISPRs represent arguably the most rapidly evolving prokaryotic loci [2931].

Sequence analysis of CRISPR loci has been used to subtype clinical isolates of Salmonella[3234], Escherichia coli[35, 36], group A Streptococcus[37] and Campylobacter species [38]. Salmonella contains two of these non-coding loci, which are comprised of direct repeats of 29 nucleotides separated by spacers of 32 nucleotides (Figure 1). Generally, CRISPR polymorphisms between Salmonella strains are due to deletion or repetition of one or more spacers, termed ‘spacer microevolution’ [3234, 39, 40]. An extensive investigation of 738 isolates, representing several different serovars, showed that polymorphisms within the CRISPR loci correlate highly with serovar, with isolates from individual serovars bearing distinct CRISPR patterns [32].
https://static-content.springer.com/image/art%3A10.1186%2F1471-2180-13-254/MediaObjects/12866_2013_Article_2128_Fig1_HTML.jpg
Figure 1

Salmonella CRISPR loci. Salmonella have two CRISPR loci, CRISPR1 and CRISPR2 comprised of direct repeats of 29 nucleotides (black diamonds) separated by spacers (empty rectangles). There is an A-T rich leader sequence upstream of each locus (shaded rectangle) and the CRISPR-associated genes (cas) are upstream of the CRISPR1 locus (grey boxed arrow). Primers used for amplification are shown in blue and red for CRISPR1 and CRISPR2, respectively.

We recently developed a sequence-based subtyping assay (multi-virulence locus sequence typing; MVLST) for Salmonella that involves the sequencing of two virulence genes, fimH1 (fimH) and sseL, in addition to CRISPR sequencing [33]. Preliminary studies showed that this approach, termed CRISPR-MVLST, provided better discrimination than either CRISPR or MVLST alone and, importantly, exhibited strong epidemiologic concordance among eight out of nine of the most common illness-causing Salmonella enterica serovars [33], including both S. Heidelberg and S. Typhimurium outbreak strains. Subsequently, among a large number of clinical isolates of the highly clonal S. Enteritidis, a combination of CRISPR-MVLST and PFGE was required to provide a sufficient discriminatory power [34]. Among a large set of S. Newport clinical isolates, CRISPR-MVLST provides similar discrimination to PFGE [41].

To further determine the functionality of this new subtyping approach, we investigated the discriminatory power of both CRISPR-MVLST and PFGE among a larger and unbiased collection of clinical S. Typhimurium and S. Heidelberg isolates that were collected over a five year period. We show here that a combination of both CRISPR-MVLST and PFGE is required to achieve an appropriate discriminatory power for S. Heidelberg. For S. Typhimurium, both subtyping methods independently provide a discriminatory power >0.94. Importantly, as one of the first applications of CRISPR-MVLST to analyze isolates that were part of an outbreak, we were able to cluster two different S. Typhimurium outbreak strains.

Results

Results of CRISPR-MVLST

To more accurately determine the discriminatory power of CRISPR-MVLST and PFGE for S. Heidelberg and S. Typhimurium, we subtyped 89 and 86 isolates, respectively, that were obtained from the Pennsylvania Department of Health (Table 1). Among the 175 total isolates analyzed, we identified 29 CRISPR1 alleles, 31 CRISPR2 alleles, 6 fimH alleles and 7 sseL alleles (Table 2). Of these, we found 27, 30, 2 and 4 alleles, respectively, that were novel and not seen in our previous data sets [33]. In total, these alleles defined 58 novel sequence types among the two serovars (Tables 3 and 4). The overwhelming sequence-type diversity among both of these prevalent serovars is provided by genetic variability in the CRISPR loci, rather than in either fimH or sseL (Figure 2). We found that 88/89 S. Heidelberg isolates had fimH allele 7 and in S. Typhimurium there were two predominant fimH alleles, allele 6 (52/86 isolates) and allele 8 (28/86 isolates). Similarly, in S. Heidelberg, 88/89 isolates bore sseL allele 19 and in S. Typhimurium, 73/86 isolates had sseL allele 15. The polymorphisms between different sseL or fimH alleles arise from the presence of SNPs with the exception of allele 63 that has a single base insertion. No alleles for any of the four markers were shared among the two different serovars, consistent with previously published studies [3234].
Table 1

List of 175 S. Heidelberg and S. Typhimurium isolates from the Pennsylvania Department of Health that were analyzed in this study

Isolate

Sequence type

PFGE pattern

PA region

Isolation date

S. Heidelberg

    

06E00444

HST 7

JF6X01.0022

SE

Mar-06

06E00726

HST 7

JF6X01.0022

SE

Jun-06

06E01437

HST 7

JF6X01.0022

SE

Aug-06

07E00466

HST 7

JF6X01.0022

SE

Apr-07

07E00768

HST 7

JF6X01.0022

NC

May-07

07E01405

HST 7

JF6X01.0022

SE

Aug-07

07E01505

HST 7

JF6X01.0022

SE

Aug-07

08E00753

HST 7

JF6X01.0022

NE

Jun-08

08E01373

HST 7

JF6X01.0022

SE

Aug-08

09E00637

HST 7

JF6X01.0022

SE

Mar-09

09E00701

HST 7

JF6X01.0022

SE

Mar-09

09E00750

HST 7

JF6X01.0022

SE

Apr-09

09E00782

HST 7

JF6X01.0022

SE

Apr-09

09E01149

HST 7

JF6X01.0022

SE

May-09

09E01511

HST 7

JF6X01.0022

SE

Jun-09

M09019838001A

HST 7

JF6X01.0022

SE

Aug-09

M10003150001A

HST 7

JF6X01.0022

SE

Jan-10

M10014816001A

HST 7

JF6X01.0022

SE

Jun-10

M10016406001A

HST 7

JF6X01.0022

SE

Jul-10

M10022189001A

HST 7

JF6X01.0022

SE

Sep-10

M11012103001A

HST 7

JF6X01.0022

SW

Apr-11

M11017212001A

HST 7

JF6X01.0022

SE

Jul-11

M11021620001A

HST 7

JF6X01.0022

SW

Aug-11

06E00846

HST 7

JF6X01.0032

SW

Jun-06

08E00963

HST 7

JF6X01.0033

SW

Jul-08

08E01089

HST 7

JF6X01.0033

SE

Jul-08

07E01378

HST 7

JF6X01.0034

SW

Jul-07

08E00470

HST 7

JF6X01.0034

NE

May-08

08E00508

HST 7

JF6X01.0034

NE

May-08

M10000626001A

HST 7

JF6X01.0034

SW

Dec-09

07E00964

HST 7

JF6X01.0042

NW

Jun-07

M11025202001A

HST 7

JF6X01.0042

SC

Oct-11

M11027881001A

HST 7

JF6X01.0042

NE

Nov-11

07E01870

HST 7

JF6X01.0045

SC

Sep-07

M09021251001A

HST 7

JF6X01.0051

SE

Sep-09

09E00927

HST 7

JF6X01.0058

SE

May-09

08E00342

HST 7

JF6X01.0080

SE

Mar-08

M11018110001A

HST 7

JF6X01.0087

NW

Jul-11

06E00558

HST 7

JF6X01.0122

NW

 

07E00680

HST 7

JF6X01.0122

SW

May-07

07E02336

HST 7

JF6X01.0161

SW

Nov-07

07E02139

HST 7

JF6X01.0167

SW

Oct-07

M09033280001A

HST 7

JF6X01.0221

SE

Dec-09

M10004098001A

HST 7

JF6X01.0246

SE

Feb-10

08E01461

HST 7

JF6X01.0324

SE

Aug-08

09E00128

HST 7

JF6X01.0324

SE

Jan-09

M09015668001A

HST 7

JF6X01.0326

SE

Jul-09

M10015955001A

HST 7

JF6X01.0581

SW

Jul-10

06E01523

HST 8

JF6X01.0051

SE

Sep-06

08E00143

HST 9

JF6X01.0022

NE

Feb-13

08E01679

HST 9

JF6X01.0022

SC

Sep-08

06E01915

HST 9

JF6X01.0022

SC

Oct-06

07E00349

HST 9

JF6X01.0022

SW

Feb-07

07E02366

HST 9

JF6X01.0022

NE

Dec-07

09E01408

HST 9

JF6X01.0022

SW

Jun-09

M10006052001A

HST 9

JF6X01.0022

SW

Mar-10

M10021328001A

HST 9

JF6X01.0022

SC

Sep-10

M11000821001A

HST 9

JF6X01.0041

NW

Jan-11

06E00519

HST 9

JF6X01.0052

NE

Apr-06

07E00933

HST 10

JF6X01.0051

SC

Jun-07

08E00107

HST 11

JF6X01.0085

NE

Jan-08

09E00226

HST 12

JF6X01.0022

SE

Jan-09

M10020282001A

HST 13

JF6X01.0034

NC

Sep-10

07E02483

HST 14

JF6X01.0022

SC

Dec-07

08E00103

HST 14

JF6X01.0022

SE

Jan-08

07E00451

HST 15

JF6X01.0049

SC

Mar-07

08E01904

HST 15

JF6X01.0049

SW

Sep-08

08E01911

HST 15

JF6X01.0049

SW

Oct-08

07E01400

HST 16

JF6X01.0270

SE

Jul-07

M10004892001A

HST 17

JF6X01.0041

SE

Mar-10

M11005464001A

HST 17

JF6X01.0041

SW

Feb-11

M11000267001A

HST 17

JF6X01.0500

NW

Dec-10

M09020244001A

HST 18

JF6X01.0321

SW

Aug-09

M09022904001A

HST 19

JF6X01.0022

NE

Sep-09

M11020321001A

HST 20

JF6X01.0042

SE

Aug-11

M10018092001A

HST 21

JF6X01.0033

SW

Aug-10

M11011342001A

HST 21

JF6X01.0058

SW

Apr-11

M11013202001A

HST 21

JF6X01.0058

SW

May-11

M11015845001A

HST 21

JF6X01.0058

SW

Jun-11

M11015850001A

HST 21

JF6X01.0058

SW

Jun-11

M11023722001A

HST 21

JF6X01.0058

SW

Sep-11

M11005685001A

HST 21

JF6X01.0582

SW

Feb-11

M10002453001A

HST 22

JF6X01.0032

SC

Jan-10

M09016444001A

HST 22

JF6X01.0033

NC

Jul-09

07E02184

HST 23

JF6X01.0042

SE

Oct-07

07E01907

HST 24

JF6X01.0058

SW

Sep-07

06E00416

HST 25

JF6X01.0172

NC

Mar-06

06E00661

HST 26

JF6X01.0022

SE

Jun-06

06E01299

HST 27

JF6X01.0022

SE

Aug-06

S. Typhimurium

    

07E00002

TST 9

JPXX01.0177

 

Dec-06

07E02276

TST 9

JPXX01.0177

 

Nov-07

08E02063

TST 9

JPXX01.0177

 

Oct-08

09E00003

TST 9

JPXX01.0177

 

Dec-08

M09023403001A

TST 9

JPXX01.0177

 

Sep-09

07E01490

TST 10

JPXX01.0003

 

Aug-07

07E01769

TST 10

JPXX01.0003

 

Sep-07

07E02403

TST 10

JPXX01.0003

 

Dec-07

08E00363

TST 10

JPXX01.0003

 

Apr-08

09E00309

TST 10

JPXX01.0003

 

Jan-09

M10005050001A

TST 10

JPXX01.0003

 

Feb-10

M10010138001A

TST 10

JPXX01.0003

 

Apr-10

M10023515001A

TST 10

JPXX01.0003

 

Oct-10

07E00173

TST 10

JPXX01.0018

 

Jan-07

08E00006

TST 10

JPXX01.0018

 

Dec-07

M09017753001A

TST 10

JPXX01.0018

 

Jul-09

M10003149001A

TST 10

JPXX01.0018

 

Jan-10

M10006054001A

TST 10

JPXX01.0098

 

Mar-10

07E00658

TST 10

JPXX01.0256

 

Apr-07

08E00457

TST 10

JPXX01.1011

 

Apr-08

M10018865001A

TST 10

JPXX01.2731

 

Aug-10

07E00234

TST 11

JPXX01.0442

 

Feb-07

M10001003001A

TST 11

JPXX01.0442

 

Jan-10

07E00290

TST 12

JPXX01.0022

 

Feb-07

07E00436

TST 12

JPXX01.0146

 

Mar-07

M09028540001A

TST 12

JPXX01.0146

 

Oct-09

M10012000001A

TST 12

JPXX01.0146

 

May-10

M11018826001A

TST 12

JPXX01.0604

 

Jul-11

09E01310

TST 12

JPXX01.0925

 

May-09

08E02215

TST 12

JPXX01.1302

 

Nov-08

08E00255

TST 13

JPXX01.0001

 

Feb-08

M11021986001A

TST 13

JPXX01.0081

 

Aug-11

09E00084

TST 13

JPXX01.0111

 

Dec-08

07E00868

TST 13

JPXX01.0206

 

Jun-07

07E00568

TST 13

JPXX01.0642

 

Apr-07

07E00364

TST 13

JPXX01.1212

 

Jan-07

07E01042

TST 14

JPXX01.1393

 

Jun-07

07E01180

TST 15

JPXX01.0003

 

Jun-07

08E01211

TST 15

JPXX01.0003

 

Jul-08

M11004438001A

TST 15

JPXX01.0003

 

Jan-11

M11016520001A

TST 15

JPXX01.0070

 

Jun-11

07E01365

TST 16

JPXX01.0928

 

Jul-07

08E00877

TST 17

JPXX01.0006

 

Jun-08

08E01423

TST 17

JPXX01.0006

 

Aug-08

07E02063

TST 17

JPXX01.0146

 

Oct-07

M09025088001A

TST 17

JPXX01.0146

 

Oct-09

M11002975001A

TST 17

JPXX01.0146

 

Jan-11

08E01686

TST 17

JPXX01.0416

 

Sep-08

07E02348

TST 18

JPXX01.0018

 

Nov-07

08E00618

TST 19

JPXX01.0146

 

May-08

M10000110001A

TST 19

JPXX01.0146

 

Jan-10

M10010755001A

TST 19

JPXX01.0146

 

May-10

M11025544001A

TST 19

JPXX01.0146

 

Sep-11

08E00074

TST 19

JPXX01.0557

 

Jan-08

M11011894001A

TST 19

JPXX01.2900

 

Apr-11

M09018928001A

TST 20

JPXX01.0001

 

Aug-09

08E00162

TST 20

JPXX01.0014

 

Feb-08

09E00747

TST 20

JPXX01.0014

 

Apr-09

M11029619001A

TST 20

JPXX01.0014

 

Nov-11

M10026894001A

TST 20

JPXX01.0146

 

Nov-10

08E00998

TST 21

JPXX01.0604

 

Jul-08

08E02429

TST 22

JPXX01.1396

 

Dec-08

09E00422

TST 23

JPXX01.1255

 

Feb-09

09E00632

TST 24

JPXX01.1975

 

Mar-09

09E00904

TST 25

JPXX01.2016

 

Apr-09

M09014919001A

TST 26

JPXX01.0083

 

Jun-09

M09015997001A

TST 27

JPXX01.0416

 

Jul-09

M09020496001A

TST 28

JPXX01.0146

 

Aug-09

M09021700001A

TST 29

JPXX01.0552

 

Sep-09

M10014370001A

TST 30

JPXX01.0333

 

Jun-10

M10015309001A

TST 31

JPXX01.0003

 

Jun-10

M10016817001A

TST 32

JPXX01.0324

 

Jul-10

M10025067001A

TST 33

JPXX01.0359

 

Oct-10

M10028492001A

TST 34

JPXX01.0060

 

Dec-10

M11001607001A

TST 35

JPXX01.0359

 

Jan-11

M11009301001A

TST 36

JPXX01.1678

 

Mar-11

M11012744001A

TST 37

JPXX01.0013

 

May-11

M11015184001A

TST 38

JPXX01.1833

 

Jun-11

M11022803001A

TST 39

JPXX01.0146

 

Sep-11

M10007760001A

TST 40

JPXX01.2488

 

Apr-10

M11006620001A

TST 41

JPXX01.1314

 

Feb-11

M11024498001A

TST 42

JPXX01.0351

 

Oct-11

09E01078

TST 42

JPXX01.0781

 

May-09

07E00784

TST 56

JPXX01.0359

 

May-07

08E00321

TST 57

JPXX01.1301

 

Mar-08

M09031352001A

TST 58

JPXX01.0146

 

Nov-09

The data are shown in order of Sequence Type (HST or TST) and further sorted by PFGE pattern.

Table 2

Number of alleles identified for each of the four CRISPR-MVLST markers

Serovar

fimH

sseL

CRISPR1

CRISPR2

S. Heidelberg

0 (2)

1 (2)

12 (12)

7 (8)

S. Typhimurium

2 (4)

3 (5)

13 (15)

19 (19)

Total

2 (6)

4 (7)

25 (27)

26 (27)

The total number of alleles for each locus is listed in parentheses with the number of alleles that are new in this study, as compared to Liu et al. [33], shown to the left.

Table 3

List of all S. H eidelberg CRISPR-MVLST S equence T ypes (HSTs) that were identified in this study

HST

Frequency

Allelic profile

fimH

sseL

CRISPR1

CRISPR2

HST 7

48

17

19

167

32

HST 8

1

17

19

168

209

HST 9

10

17

19

167

209

HST 10

1

17

19

169

32

HST 11

1

17

19

170

32

HST 12

1

17

19

171

32

HST 13

1

18

19

167

32

HST 14

2

17

19

179

32

HST 15

3

17

19

167

212

HST 16

1

17

19

173

213

HST 17

3

17

19

172

32

HST 18

1

17

19

178

32

HST 19

1

17

67

174

209

HST 20

1

17

19

175

32

HST 21

7

17

19

167

211

HST 22

2

17

19

167

210

HST 23

1

17

19

177

32

HST 24

1

17

19

167

214

HST 25

1

17

19

176

32

HST 26

1

17

19

177

215

HST 27

1

17

19

167

215

The numbers represent the allelic identifier for the individual CRISPR-MVLST markers. The combination of four specific alleles defines a given HST. The frequency is the number of times a particular HST was observed among the 89 S. Heidelberg isolates analyzed. All HSTs identified here were new and not seen in previous studies.

Table 4

List of all S. T yphiurium CRISPR-MVLST S equence T ypes (TSTs) that were identified in this study

TST

Frequency

Allelic profile

fimH

sseL

CRISPR1

CRISPR2a

TST 9

5

6

15

129

159*

TST 10

16

8

15

11

160

TST 11

2

6

15

10

163*

TST 12

7

6

15

10

164*

TST 13

6

6

15

129

162

TST 14

1

6

15

129

165

TST 15

4

8

15

11

161

TST 16

1

8

61

11

160

TST 17

6

6

15

10

167*

TST 18

1

8

20

131

160

TST 19

6

6

62

10

164*

TST 20

5

49

15

129

162

TST 21

1

6

15

132

164*

TST 22

1

6

15

10

168*

TST 23

1

8

20

11

160

TST 24

1

6

15

133

167*

TST 25

1

50

20

134

169*

TST 26

1

6

15

10

170*

TST 27

1

6

15

10

171*

TST 28

1

6

15

10

172*

TST 29

1

8

62

11

160

TST 30

1

6

15

137

174

TST 31

1

8

15

11

175

TST 32

1

6

15

135

162

TST 33

1

6

15

138

177*

TST 34

1

8

15

139

161

TST 35

1

6

15

140

178*

TST 36

1

8

63

11

160

TST 37

1

6

15

141

162

TST 38

1

6

15

10

179*

TST 39

1

6

15

10

180*

TST 40

1

6

15

142

173*

TST 41

1

8

20

143

166

TST 42

2

6

15

10

181**

TST 56

1

6

15

130

173*

TST 57

1

6

15

10

205**

TST 58

1

6

15

136

164*

TST 59

-

6

62

10

207*

TST 60

-

6

15

166

208*

The numbers represent the allelic identifier for the individual CRISPR-MVLST markers. The combination of four specific alleles defines a given HST. The frequency is the number of times a particular TST was observed among the 86 S. Typhimurium isolates analyzed in the first study and does not include the frequency of TSTs that were seen in the outbreak study. All TSTs identified here were new and not seen in previous studies. aSome CRISPR2 alleles required more than two sequencing primers to cover the whole length of the array. Alleles that required three primers are noted with * and the two isolates that required seven primers to sequence CRISPR2 are noted with **. The position of these primers is shown in Additional file 1.

https://static-content.springer.com/image/art%3A10.1186%2F1471-2180-13-254/MediaObjects/12866_2013_Article_2128_Fig2_HTML.jpg
Figure 2

Contribution of allele number for each marker. Pie charts showing the combined total number of different alleles identified at all four loci. The contribution of each marker to this total is shown for a) combined all alleles from both S. Heidelberg and S. Typhimurium, b) S. Heidelberg and c) S. Typhimurium. F – fimH; S – sseL.

S. Heidelberg analysis and sequence type distribution

CRISPR-MVLST analysis of 89 S. Heidelberg clinical isolates (representing 27 unique PFGE patterns) resulted in 21 unique S. Heidelberg Sequence Types (HSTs), HST 7 – HST 27 (Table 3). In total, we identified 12 CRISPR1 alleles, 8 CRISPR2 alleles, 2 fimH alleles and 2 sseL alleles (Table 2). As shown in Figure 2b, most of the allelic diversity comes from the CRISPR1 and CRISPR2 loci. All 12 CRISPR1 alleles and seven of the eight CRISPR2 alleles were new, compared to our previous studies [33]. We did not find any new fimH alleles in our dataset and only one of the two sseL alleles was new. The most frequent ST was HST7, occurring in 49/89 isolates (54%).

Discriminatory power of CRISPR-MVLST and PFGE in S.Heidelberg isolates

The discriminatory power of CRISPR-MVLST among the S. Heidelberg isolates was calculated to be 0.6931 (Figure 3a). The discriminatory power provided by PFGE among the same isolates was 0.8149 (Figure 3b). Given these low values and insufficient discriminatory power (an ideal discriminatory power is >0.95) [42], we combined the two typing methods. This combination provided 44 unique groups with a more satisfactory discriminatory power of 0.9213 (Figure 3c), suggesting a 92% confidence in ability to separate unrelated isolates.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2180-13-254/MediaObjects/12866_2013_Article_2128_Fig3_HTML.jpg
Figure 3

Frequency of S. Heidelberg subtype prevalence generated by CRISPR-MVLST and PFGE. Pie charts showing the number and frequency of distinct subtypes defined by a) CRISPR-MVLST, b) PFGE and c) the combination of CRISPR-MVLST and PFGE among 89 S. Heidelberg isolates. The most frequent subtypes for each method are indicated; .0022 and .0058 represent PFGE profiles JF6X01.0022 and JF6X01.0058, respectively. The number of distinct subtypes defined by each method is listed in parenthesis and the discriminatory power (D) is listed below. d) CRISPR-MVLST is able to separate the most common S. Heidelberg PFGE pattern JF6X01.0022 into 7 distinct sequence types.

Separation of common S. Heidelberg subtypes

Among the S. Heidelberg isolates analyzed, the most frequent PFGE pulsotype was JF6X01.0022 (42%). We were able to further subtype isolates with JF6X01.0022 pattern into 7 distinct HSTs - HST 7, 9, 12, 14, 19, 26 and 27 (Figure 3d). Among JF6X01.0022 isolates, the two most common HSTs were HST7 (62%) and HST9 (22%). JF6X01.0058 is also fairly common, occurring in 8% of isolates studied. With these isolates, we were able to further subtype them into 3 distinct HSTs – HST 7, 21 and 24, with HST21 being the most common (71%). Conversely, over half the isolates analyzed have HST 7 (54%), but by PFGE analysis, these are represented by 18 different PFGE patterns, the most frequent being JF6X01.0022 (48%). Collectively, this data highlights the strengths and weakness of each subtyping method.

S.Typhimurium analysis and sequence type distribution

CRISPR-MVLST analysis of 86 S. Typhimurium clinical isolates (representing 45 unique PFGE patterns) resulted in the identification of 37 unique and novel S. Typhimurium Sequence Types (TSTs), TST9 – TST41, and TST56 – TST58 (Table 4). This included 17 CRISPR1, 23 CRISPR2, 4 fimH and 5 sseL alleles (Table 2). Of these, the majority of CRISPR1 alleles were new (15/17 alleles) and all CRISPR2 alleles were new (23/23), as compared to our previous studies [33]. As with S. Heidelberg, the majority of unique sequence types were defined by polymorphisms in either or both of the CRISPR loci (Figure 2c).

Discriminatory power of CRISPR-MVLST and PFGE in S. Typhimurium isolates

The discriminatory power of CRISPR-MVLST among the S. Typhimurium isolates was 0.9415 (Figure 4a). This means that there would be a 94% probability that two unrelated isolates could be separated using the CRISPR-MVLST scheme. Similarly, for PFGE, the discriminatory power among these isolates is 0.9486 (Figure 4b). These values suggest that either method can provide sufficient discrimination between outbreak and non-outbreak S. Typhimurium strains.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2180-13-254/MediaObjects/12866_2013_Article_2128_Fig4_HTML.jpg
Figure 4

Frequency of S. Typhimurium subtype prevalence generated by CRISPR-MVLST and PFGE. Pie charts showing the number of distinct subtypes defined by a) CRISPR-MVLST and b) PFGE among 86 S. Typhimurium isolates. The most frequent TSTs or PFGE patterns observed are indicated. .0003 and .0146 represent PFGE profiles JPXX01.0003 and JPXX01.0146, respectively. The number of distinct subtypes defined by each method is listed in parenthesis and the discriminatory power (D) is listed below.

Correlation between different TSTs and PFGE patterns

We next wanted to investigate whether any correlation existed between TSTs and PFGE patterns. To accomplish this, we first determined the relationship among different TSTs. BURST analysis of all 37 TSTs generated four groups (Figure 5a). Of these, Groups 1–3 contain 6 – 15 TSTs. Group 4 consists of only two TSTs and BURST was unable to assign a core TST. There was also a collection of five singletons that BURST did not assign to a group. For Groups 1–3, each group comprises a core TST surrounded by TSTs that differ from the core by one allele. The number of rings in the group demonstrates the number of allele differences from the core. For example, in Group 1 TSTs 9, 37, 32, 20, and 14 each differ by one allele at one locus from the core TST, TST 13. For group 3, TST 10 is the core TST and TSTs 15, 31, 36, 29, 23 and 16 each differ from TST 10 at one locus. TST 34, in the outer ring differs from the TSTs in the middle ring at one locus and from the core at two loci.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2180-13-254/MediaObjects/12866_2013_Article_2128_Fig5_HTML.jpg
Figure 5

Correlation of CRISPR-MVLST and PFGE. a) BURST analysis of 37 TSTs identified in this study shows the relationship between different TSTs. Within a BURST group, the TSTs within one ring differ from TSTs in an adjacent ring at one of the four CRISPR-MVLST loci. TSTs that could not be assigned to a group are listed as singletons. Individual PFGE patterns that are found in isolates that have different TSTs are shown in color and the PFGE pulsotype is indicated as the numbers after JPXX01, i.e. JPXX01.0604 is shown as .0604. b) Dendrogram showing the levels of similarity between the 45 different PFGE patterns identified. All the PFGE patterns that are found in isolates with TSTs in Groups 1–3 are shaded in the corresponding color. The blue asterix represents TST 20, which is in Group 1.

To investigate whether there was any relationship between CRISPR-MVLST sequence type and PFGE patterns, we overlaid our PFGE data to identify isolates from different TSTs that have the same PFGE pattern. Figure 5a shows that there were seven PFGE pulsotypes that could be further separated into TSTs. In the majority of instances (5/7), identical PFGE patterns were found in isolates that had closely related TSTs such as JPXX01.0003 and JPXX01.0604 (TSTs 15, 31, 10 and TSTs 12 and 21, respectively).

Following this, we then generated a dendrogram using the Dice coefficient to determine the relationship between different PFGE pulsotypes. For clarity, we color-coded the PFGE patterns according to the BURST Group shown in Figure 5a. As can be seen in Figure 5b, closely related CRISPR-MVLST sequence types have similar PFGE patterns.

CRISPR-MVLST analysis of S. Typhimurium outbreak isolates

Since CRISPR-MVLST and PFGE exhibit a similarly high discriminatory ability in S. Typhimurium, we wanted to investigate the utility of the former for separating outbreak isolates. We obtained 30 S. Typhimurium isolates from the Pennsylvania Department of Health (Table 5). Ten of these were isolates associated with an outbreak in 2004 with the cluster designation 0411PAJPX-1c. All affected persons were on a bus trip together, though the outbreak source was never identified. The remaining 20 isolates comprised 10 isolates that were linked to a 2009 live poultry outbreak (cluster 0905PAJPX-1) and 10 control isolates that were isolated in the same year but were not part of any classified outbreaks.
Table 5

List of 30 S. Typhimurium isolates used in the outbreak study

Isolate

Sequence type

PFGE-pattern ( XbaI)

PFGE pattern ( BlnI)

Outbreak cluster

04E02240

TST 59

JPXX01.0146

JPXA26.0172

0411PAJPX-1c

04E02241

TST 59

JPXX01.0146

JPXA26.0294

0411PAJPX-1c

04E02243

TST 59

JPXX01.0146

JPXA26.0172

0411PAJPX-1c

04E02295

TST 59

JPXX01.0146

JPXA26.0172

0411PAJPX-1c

04E02296

TST 59

JPXX01.0146

JPXA26.0172

0411PAJPX-1c

04E02297

TST 59

JPXX01.0146

JPXA26.0172

0411PAJPX-1c

04 F00368

TST 59

JPXX01.0146

JPXA26.0172

0411PAJPX-1c

04 F00376

TST 59

JPXX01.0146

JPXA26.0172

0411PAJPX-1c

04 F00381

TST 59

JPXX01.0146

JPXA26.0172

0411PAJPX-1c

04E02239

TST 59

JPXX01.0279

JPXA26.0172

0411PAJPX-1c

09E00857

TST 42

JPXX01.0302

JPXA26.0183

0905PAJPX-1

09E01235

TST 42

JPXX01.0302

JPXA26.0183

0905PAJPX-1

09E01308

TST 42

JPXX01.0302

JPXA26.0183

0905PAJPX-1

09E01333

TST 42

JPXX01.0302

JPXA26.0183

0905PAJPX-1

09E01424

TST 42

JPXX01.0302

JPXA26.0183

0905PAJPX-1

09E01666

TST 42

JPXX01.0302

JPXA26.0183

0905PAJPX-1

M09015209001A

TST 42

JPXX01.0302

JPXA26.0183

0905PAJPX-1

M09017319001A

TST 42

JPXX01.0302

JPXA26.0183

0905PAJPX-1

M09019457001A

TST 42

JPXX01.0302

JPXA26.0183

0905PAJPX-1

M09021164001A

TST 42

JPXX01.0302

JPXA26.0183

0905PAJPX-1

M09015294001A

TST 42

JPXX01.0047

-

-

M09019934001A

TST 42

JPXX01.0781

-

-

M09015723001A

TST 12

JPXX01.0604

JPXA26.0292

-

M09019606001A

TST 12

JPXX01.0604

JPXA26.0174

-

M09016911001A

TST 12

JPXX01.1214

-

-

09E00951

TST 13

JPXX01.0001

JPXA26.0530

-

M09019186001A

TST 13

JPXX01.0946

-

-

09E01471

TST 15

JPXX01.2095

-

-

M09016893001A

TST 19

JPXX01.0146

JPXA26.0291

-

M09017200001A

TST 60

JPXX01.0359

-

-

The 10 isolates without cluster information represent the sporadic, or non-outbreak related, isolates used as controls in the study.

CRISPR-MVLST was able to separate the 2004 isolates, with each isolate bearing the unique TST59 (Tables 4 and 5). These isolates were also analyzed by two-enzyme PFGE, using XbaI and BlnI. Though they had the same TST, two of the isolates, 04E02241 and 04E02239 had different PFGE patterns with BlnI or XbaI, respectively, and are indicated in bold in Table 5. This example shows that CRISPR-MVLST provides an epidemiologic concordance of 1 (E = 1.0) and for PFGE it is less than 1 (E < 1.0). Additionally, the XbaI PFGE pattern associated with this strain, JPXX01.0146, occurred fairly frequently in our initial data set; 12/86 isolates had this pulsotype and we were able to separate these into seven different TSTs.

For the 2009 outbreak isolates, CRISPR-MVLST correctly identified the 10 outbreak isolates (TST42) and these all have the same PFGE pattern, JPXX01.0302, thus for both subtyping methods E = 1.0. Two of the sporadic case control isolates were also TST42 (shown in bold in Table 5) but these had different PFGE pulsotypes from the outbreak strain, suggesting a lack of discrimination by CRISPR-MVLST in this instance. TST42 was seen in two isolates in the initial study of 86 S. Typhimurium isolates. All isolates within each outbreak were identified using CRISPR-MVLST, thus obtaining perfect epidemiological concordance with this subtyping method.

Discussion

Foodborne illness caused by Salmonella enterica species, particularly by S. Typhimurium and S. Heidelberg, accounts for 18.5% of salmonellosis annually in the United States [4]. For accurate outbreak tracking and routine disease surveillance, it is critical that we employ rapid, efficient and robust subtyping methodologies. PFGE is the current gold standard for molecular subtyping of Salmonella and other methods include AFLP, MVLA and CRISPR-MVLST.

CRISPR sequence analysis is one of the cheaper and faster methods for Salmonella subtyping [22]. For the majority of isolates analyzed, CRISPR-MVLST could be completed in less than 24 hours, including DNA isolation and analysis. Additionally, by virtue of their nature, sequencing data are more robust and tractable; this type of data is unequivocal and, with regards to inter-laboratory or database use, is highly consistent. They also provide increased downstream utilities that involve analysis of sequence information, such as phylogenetic studies. This approach is also in line with other high-throughput subtyping approaches, including real-time CRISPR analysis [32] and whole genome sequence analysis [4347]. Conversely, although protocols exist that allow PFGE to be completed in 24 hours, it can often take 1–3 days, requires skilled personnel, inter-laboratory data analysis can be challenging and the data have no utility beyond subtyping. Given the advancement of whole-genome sequencing technologies, typing methods based on these are in development [48]. While highly discriminatory, limitations to this approach that are not issues with either CRISPR-MVLST or PFGE include the time required for analysis and space required for data storage.

CRISPR spacer analysis alone has been used to analyze several different Salmonella serovars [32]. Fabre and colleagues showed that among 50 isolates of S. Typhimurium and its I,4, [5],12:i- variant, combined CRISPR1 and CRISPR2 sequence information is comparable to PFGE (D = 0.88 and 0.87, respectively). Both methods were more discriminatory than phage typing analysis of the same set of isolates. The same study also analyzed spacer content of S. Typhimurium and S. Enteritidis from 10 outbreaks and in all cases CRISPR sequences exhibited high epidemiologic concordance.

A preliminary investigation showed that addition of CRISPR spacer analysis to an MVLST scheme improves discrimination, beyond that provided by either approach independently, in eight out of nine of the most common illness-causing Salmonella serovars [33]. We wanted to extend our evaluation of CRISPR-MVLST utility among predominant and clinically relevant Salmonella serovars. To date we have tested and compared CRISPR-MVLST to PFGE on large numbers of S. Enteritidis [34], S. Newport [41]S, Heidelberg and S. Typhimurium isolates. Among the total 175 isolates analyzed here, we found significantly fewer alleles of fimH and sseL, compared to alleles of either CRISPR locus (Table 2; Figure 2). Given the reduced contribution of the virulence genes to defining STs, their addition may seem superfluous within this subtyping scheme. However, in this data set, fimH alleles define two STs, HST13 and TST20 and sseL alleles define five STs, TST16, TST19, TST23, TST29 and TST36. This further supports earlier findings showing that addition of MVLST to a CRISPR-based subtyping scheme increases discrimination in S. Enteritidis [34] as well as among a broad set of Salmonella enterica serovars [33].

Though the number of isolates for each serovar was similar, the number of STs within each serovar is surprisingly disparate: among 89 S. Heidelberg isolates we identified 21 HSTs and in 86 S. Typhimurium isolates, we identified 37 TSTs. This presumably reflects varied levels of clonality in different serovars. Independently of the number of STs defined for either serovar, the CRISPR loci are responsible for the vast majority of alleles: (S. Heidelberg – 83.3% and S. Typhimurium – 80%) (Figure 2). In S. Heidelberg, 50% of the different alleles identified were CRISPR1 alleles. Given that CRISPRs are of one of the more dynamic loci in bacteria [30, 31], this finding is not unexpected.

Although PFGE was more discriminatory than CRISPR-MVLST among 89 S. Heidelberg isolates (D = 0.81 versus 0.69, respectively), a combination of both techniques provided an improved value of 0.92. This represents a 92% probability that two unrelated strains can be separated. JF6X01.0022 is the most common PFGE pattern in PulseNet for S. Heidelberg [49] and is seen 30–40 times a month by the CDC. In our data set, 42% of the isolates have the JF6X01.0022 pattern and using CRISPR-MVLST, we were able to further separate these into seven distinct CRISPR-MVLST types (Figure 3b and d). Given the frequency at which this PFGE pattern occurs nationally, not all isolates that have this pattern may be associated with a specific outbreak, further enhancing the utility of CRISPR-MVLST as a complement to PFGE analysis. Collectively, these findings in S. Heidelberg show that the JF6X01.0022 pattern is analogous to the JEGX01.0004 pattern in S. Enteritidis, where the latter was observed in 51% of isolates analyzed and was separated into 12 distinct STs [34]. A proposed improvement for discrimination in S. Heidelberg and S. Enteritidis by PFGE is to increase the number of enzymes used for PFGE analysis [50, 51], though the concurrent use of PFGE and CRISPR-MVLST would be much more efficient than this approach.

Regarding S. Heidelberg, our data are similar to that observed in a broad set of S. Enteritidis isolates [34]: both serovars exhibit fewer number of STs identified and both require combining CRISPR-MVLST and PFGE to obtain a sufficient discriminatory power. This presumably reflects similar levels of clonality in S. Heidelberg and S. Enteritidis as compared to more heterogenous serovars such as S. Typhimurium where we observed many more STs present within a similar number of isolates examined.

Our data show that in S. Typhimurium, the discrimination provided by either PFGE or CRISPR-MVLST is similar (0.9486 versus 0.9415, respectively). When CRISPR-MVLST was applied to outbreak isolates, we were able to correctly identify the 20 isolates representing the two outbreaks, showing an extremely good epidemiologic concordance with this typing method. The epidemiologic concordance was better by CRISPR-MVLST than PFGE in identifying isolates from the 2004 bus trip outbreak and both methods had equal epidemiological concordance for the 2009 live poultry outbreak. Regarding the 2004 outbreak, the majority of isolates had the JPXX01.0146 pulsotype. In our initial study, this pulsotype was seen frequently, 16% of all isolates analyzed, and the 14 isolates with this pattern could also be represented by 7 distinct TSTs. Conversely, all isolates from this outbreak have TST59, which is unique and not seen in our initial data set showing that in this instance, CRISPR-MVLST may be a better subtyping approach. In analyzing the 2009 live poultry outbreak, it appears that PFGE is more discriminatory than CRISPR-MVLST, as CRISPR-MVLST also identified two non-outbreak related isolates as TST42. Given the available epidemiological data available, these two isolates do not appear to be associated with the outbreak. The fact that CRISPR-MVLST works better in some instances than others is not surprising and can also occur when other subtyping methods are used. ‘Problematic’ PFGE pulsotypes also exist and is one reason that second generation methods like MLVA and CRISPR-MVLST are being developed [33, 52]. As a recent example, isolates associated with the 2012 S. Typhimurium cantaloupe outbreak, had a common PFGE pattern so additional subtyping by MLVA was performed to correctly define the outbreak strain [24]. That there is a strong association among closely related sequence types and closely related PFGE patterns for both S. Typhimurium (Figure 5) and S. Newport [41] provides further evidence that CRISPR-MVLST could serve as an appropriate alternative subtyping method.

Beyond the data shown here and in further evaluating the value of CRISPR-MVLST sequence typing, a recent study investigating S. Typhimurium isolates from a variety of animal sources showed an association of CRISPR-MVLST sequence types and resistance to antibiotics [40]. As part of that study, the most frequent TSTs were TST10 and TST42, both of which were found in this current study. TST10 was also the most frequent clinical sequence type seen in this study (16/86 isolates) but only two isolates were TST42.

Conclusion

CRISPR-MVLST is a relatively new subtyping approach with limited studies conducted in Salmonella that demonstrate its utility [33, 34, 39]. Our data here add to this body of work by demonstrating its functionality in two highly prevalent clinical serovars. Investigation of several more outbreak strains using CRISPR-MVLST will elucidate the true capability of this subtyping method. Our data here show that CRISPR-MVLST can be used in concert with PFGE, as in the case of S. Heidelberg, or potentially as an independent subtyping method, as in the case of S. Typhimurium.

Methods

Bacterial isolates and sample preparation

A summary of all isolates analyzed in this study is listed in Table 5. A total of 89 and 86 clinical isolates of S. Heidelberg and S. Typhimurium, respectively, were obtained from the Pennsylvania Department of Health. These isolates were selected systematically (isolates received closest to the 1st and 15th of each month from 2005 – 2011 were selected) to represent an unbiased collection of human clinical isolates. PFGE-XbaI analysis of these isolates was conducted using standard protocols [7, 53]. All isolates were stored at -80°C in 20% glycerol. Isolates were grown overnight in 2 mL LB at 37°C in a shaking incubator. DNA was isolated using the Promega genomic DNA isolation kit, following the manufacturer’s directions (Promega, Madison, WI). DNA samples were stored at -20°C prior to PCR analysis.

PCR amplification

Primers for amplification of all four genomic loci are listed in Table 6. PCR reactions were performed in a total volume of 25 μl: 1.5 μl template, 0.3 μl Taq (1.5 units; New England Bio Labs, Ipswich, MA), 0.2 μl 10 mM dNTPs, 1 μl of each 10 μM primer, 2.5 μl of 10× Taq buffer and 18.5 μl water. PCR conditions were as follows and the annealing temperatures (AT) are listed in Table 6: initial denaturation step of 10 minutes at 94°C followed by 35 cycles of 1 minute at 94°C, 1 minute at AT and extension for 1 minute (fimH and sseL) or 1.5 minutes (CRISPR1 and CRISPR2) at 72°C; a final extension step was done at 72°C for 8 minutes. 5 μl of each PCR product was electrophoretically analyzed on a 1.2% agarose gel and the remaining reaction stored at -20°C.
Table 6

List of primers used in this study for PCR amplification and sequencing of the four CRISPR-MVLST markers

Primer

Orientation

Primer sequence (5′-3′)

Annealing temp.

PCR

Sequencing

CRISPR1-5

Forward

TGAAAACAGACGTATTCCGGTAGATT

55.5

CRISPR1-1

Reverse

CAGCATATTGACAAGGCGCT

CRISPR2-3

Forward

ATTGTTGCGATTATGTTGGT

57

CRISPR2-1

Reverse

TCCAGCTCCCTTATGATTTT

 

CRISPR2-4

Reverse

GCAATACCCTGATCCTTAACGCCA

  

CRISPR2-5

Reverse

CGACGAAATTAAAACCGAACT

  

CRISPR2-6

Forward

CGGATTCCATGCGTTTTCA

  

CRISPR2-7

Forward

CCGGCGAGGTCAATAAAA

  

CRISPR2-8

Forward

TGACGCTGGTCTATACCG

  

CRISPR2-9

Forward

GTGACGTCAGTGCCGAA

  

CRISPR2-10

Reverse

CTCTTCGCACTCTCGATCAA

  

fimH-1

Forward

AGGTGAACTGTTCATCCAGTGG

56.7

fimH-2

Reverse

GCGGGCTGAACAAAACACAA

sseL-1

Forward

AAAATCAGGTCTATGCCTGATTTAATATATC

60

 

sseL-2

Reverse

GGCTCTAAGTACTCACCATTACT

 

sseL-3

Forward

ACCAGGAAACAGAGCAAAATGAATATATGT

  

sseL-4

Forward

TTCTCTCGGTAAACTATCCTATTGGGC

  

DNA sequencing

PCR products were treated with 10 units of Exonuclease (New England Bio Labs, Ipswich, MA) and 1 unit of Antarctic alkaline phosphatase (New England Bio Labs, Ipswich, MA). The mixture was incubated for 40 minutes at 37°C to remove remaining primers and unincorporated dNTPs. The enzymes were inactivated by incubating the samples at 85°C for 15 minutes. Purified PCR products were sequenced at the Huck Institute’s Nucleic Acid Facility at The Pennsylvania State University using 3’ BigDye-labeled dideoxynucleotide triphosphates (v 3.1 dye terminators; LifeTechnoloties, Carlsbad, CA) and run on an ABI 3730XL DNA Analyzer, using ABI Data Collection Program (v 2.0). Data was analyzed with ABI Sequencing Analysis software (Version 5.1.1). The primers used for sequencing are listed in Table 6. In total, four PCR reactions and eight sequencing reactions were conducted for each isolate being typed. Additionally, one internal sequencing reaction was required for 14/26 S. Typhimurium CRISPR2 alleles, due to the increased length of this locus. There were two alleles (only representing 2/86 S. Typhimurium isolates), 181 and 205, which required extra primers due to the presence of a duplicated region of the locus. The positions of these extra primers are shown in Additional file 1: Figure S1. CRISPR2 alleles that were sequenced using more than two primers are indicated in Table 3.

Sequence analysis and sequence type assignment

Sequences were assembled and aligned using SeqMan and MegAlign, respectively (Lasergene 10, DNA Star, Madison, WI) and unique alleles were assigned a unique numerical designation. All sequences from this study were submitted as a batch to NCBI and the accession numbers (KF465853 - KF465929) are shown for each allele in Additional file 2. For each isolate the combination of allelic types at all four loci defines the serovar-designated sequence type (ST) (Tables 2 and 3), with each unique allelic type assigned a different ST number. The presence of a SNP in any marker was sufficient to define a new allele. Analysis of CRISPR1 and CRISPR2 was performed using CRISPR-finder (http://crispr.u-psud.fr/Server/). We did not identify any SNPs within either CRISPR locus that defined any allele. Allelic differences occurred from deletion of one or more spacers, addition of a spacer or duplication/triplication of a spacer. Discriminatory power was calculated using the method described by Hunter and Gaston [54], with strains defined as either unique STs or unique PFGE patterns.

Relationships between TSTs were calculated using BURST (http://www.pubmlst.org/analysis/), with a group definition of n-1. Unique PFGE patterns, or pulsotypes, were defined by PulseNet, using the Dice coefficient with an optimization of 1.5% and a position tolerance of 1.5%. The difference of one band is sufficient to call two PFGE patterns different. PFGE dendrograms were generated using BioNumerics v. 6.6.

S.Typhimurium outbreak study

A summary of 30 S. Typhimurium outbreak isolates that were obtained from the Pennsylvania Department of Health is listed in Table 4. Ten of these isolates associated with an outbreak in 2004 (cluster 0411PAJPX-1c) where affected patients had been on a bus trip together, though no vector was ever identified. Another 10 isolates were linked to an outbreak in 2009 (cluster 0905PAJPX-1), which was associated with live poultry. The remaining 10 isolates represent sporadic case isolates, also from 2009 but were not associated with the 0905PAJPX-1 outbreak and thus served as controls. The isolates were cultured as described above.

Consent and institutional review board (IRB) approval

This study design was reviewed by the Pennsylvania Department of Health IRB and was determined to be exempt under federal regulations as it falls within the category “research that involves the collection or study of existing data, documents, records, pathological specimens, or diagnostic specimens where the information is recorded by the investigator in such a manner that subjects cannot be identified, directly or through identifiers linked to the subjects”.

Declarations

Acknowledgments

The authors would like to thank Margaret Kirchner and Steven Strutt for assistance with DNA isolations and Dr. Stephen Knabel for critically reading the manuscript. We would also like to acknowledge the Huck Institute’s Nucleic Acid Facility at Penn State University.

This study was supported by a United States Army Research Office grant to E.G.D (W911NF-11-1-0442).

Authors’ Affiliations

(1)
Department of Food Science, The Pennsylvania State University
(2)
The Pennsylvania Department of Health, Bureau of Laboratories, Division of Clinical Microbiology
(3)
Department of Food, Bioprocessing and Nutrition Sciences, North Carolina State University

References

  1. Scallan E, Hoekstra RM, Angulo FJ, Tauxe RV, Widdowson M-A, Roy SL, Jones JL, Griffin PM: Foodborne illness acquired in the United States—major pathogens. Emerg Infect Dis. 2011, 17: 7-15.PubMedPubMed CentralView Article
  2. Hoffmann S, Batz MB, Morris JG: Annual cost of illness and quality-adjusted life year losses in the united states due to 14 foodborne pathogens. J Food Prot. 2012, 75: 1292-1302. 10.4315/0362-028X.JFP-11-417.PubMedView Article
  3. Scharff RL: Economic burden from health losses due to foodborne illness in the United States. J Food Prot. 2012, 75: 123-131. 10.4315/0362-028X.JFP-11-058.PubMedView Article
  4. Centers for Disease Control and Prevention: National Salmonella Surveillance Annual Summary 2009. 2009, http://www.cdc.gov/ncidod/dbmd/phlisdata/salmonella.htm [Accessed March 4, 2013]
  5. Multistate Outbreak of Salmonella Heidelberg Infections Linked to Chicken. http://www.cdc.gov/salmonella/heidelberg-02-13/index.html,
  6. Multistate Outbreak of Salmonella Typhimurium Infections Linked to Ground Beef. http://www.cdc.gov/salmonella/typhimurium-01-13/,
  7. Ribot EM, Fair MA, Gautom R, Cameron DN, Hunter SB, Swaminathan B, Barrett TJ: Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for pulsenet. Foodborne Pathog Dis. 2006, 3: 59-67. 10.1089/fpd.2006.3.59.PubMedView Article
  8. Lindstedt B-A, Heir E, Vardund T, Kapperud G: Fluorescent amplified-fragment length polymorphism genotyping of Salmonella enterica subsp. enterica serovars and comparison with pulsed-field gel electrophoresis typing. J Clin Microbiol. 2000, 38: 1623-1627.PubMedPubMed Central
  9. Torpdahl M, Skov MN, Sandvang D, Baggesen DL: Genotypic characterization of Salmonella by multilocus sequence typing, pulsed-field gel electrophoresis and amplified fragment length polymorphism. J Microbiol Methods. 2005, 63: 173-184. 10.1016/j.mimet.2005.03.006.PubMedView Article
  10. Hu H, Lan R, Reeves PR: Fluorescent amplified fragment length polymorphism analysis of Salmonella enterica serovar Typhimurium reveals phage-type- specific markers and potential for microarray typing. J Clin Microbiol. 2002, 40: 3406-3415. 10.1128/JCM.40.9.3406-3415.2002.PubMedPubMed CentralView Article
  11. Larsson JT, Torpdahl M, Petersen RF, Sørensen G, Lindstedt B-A, Nielsen EM: Development of a new nomenclature for Salmonella Typhimurium multilocus variable number of tandem repeats analysis (MLVA). Eurosurveillance. 2009, 14: 1-5.
  12. Torpdahl M, Sørensen G, Lindstedt B-A, Nielsen EM: Tandem repeat analysis for surveillance of human Salmonella Typhimurium infections. Emerg Infect Dis. 2007, 13: 388-395. 10.3201/eid1303.060460.PubMedPubMed CentralView Article
  13. Ross IL, Heuzenroeder MW: Discrimination within phenotypically closely related definitive types of Salmonella enterica serovar Typhimurium by the multiple amplification of phage locus typing technique. J Clin Microbiol. 2005, 43: 1604-1611. 10.1128/JCM.43.4.1604-1611.2005.PubMedPubMed CentralView Article
  14. Lindstedt BE, Heir E, Gjernes E, Kapperud G: DNA fingerprinting of Salmonella enterica subsp. enterica serovar Typhimurium with emphasis on phage type DT104 based on variable number of tandem repeat loci. J Clin Microbiol. 2003, 41: 1469-1479. 10.1128/JCM.41.4.1469-1479.2003.PubMedPubMed CentralView Article
  15. Ramisse V, Houssu P, Hernandez E, Denoeud F, Hilaire V, Lisanti O, Ramisse F, Cavallo J-D, Vergnaud G: Variable number of tandem repeats in Salmonella enterica subsp. enterica for typing purposes. J Clin Microbiol. 2006, 42: 3849-3854.
  16. Witonski D, Stefanova R, Ranganathan A, Schutze GE, Eisenach KD, Cave MD: Variable-number tandem repeats that are useful in genotyping isolates of Salmonella enterica subsp. enterica serovars Typhimurium and Newport. J Clin Microbiol. 2006, 44: 3849-3854. 10.1128/JCM.00469-06.PubMedPubMed CentralView Article
  17. Lindstedt B-A, Vardund T, Aas L, Kapperud G: Multiple-locus variable-number tandem-repeats analysis of Salmonella enterica subsp. enterica serovar Typhimurium using PCR multiplexing and multicolor capillary electrophoresis. J Microbiol Methods. 2004, 59: 163-172. 10.1016/j.mimet.2004.06.014.PubMedView Article
  18. Young C-C, Ross IL, Heuzenroeder MW: A New methodology for differentiation and typing of closely related Salmonella enterica serovar Heidelberg isolates. Curr Microbiol. 2012, 65: 481-487. 10.1007/s00284-012-0179-3.PubMedView Article
  19. Fang N, Huang B, Hiley L, Bates J, Savill J: A rapid multiplex DNA suspension array method for Salmonella Typhimurium subtyping using prophage-related markers. J Microbiol Methods. 2012, 88: 19-27. 10.1016/j.mimet.2011.10.002.PubMedView Article
  20. Kérouanton A, Marault M, Lailler R, Weill F-X, Feurer C, Espié E, Brisabois A: Pulsed-field gel electrophoresis subtyping database for foodborne Salmonella enterica serotype discrimination. Foodborne Pathog Dis. 2007, 4: 293-303. 10.1089/fpd.2007.0090.PubMedView Article
  21. Goering RV: Pulsed field gel electrophoresis: a review of application and interpretation in the molecular epidemiology of infectious disease. Infect Genet Evol. 2010, 10: 866-875. 10.1016/j.meegid.2010.07.023.PubMedView Article
  22. Wattiau P, Boland C, Bertrand S: Methodologies for Salmonella enterica subsp. enterica subtyping: gold standards and alternatives. Appl Environ Microbiol. 2011, 77: 7877-7885. 10.1128/AEM.05527-11.PubMedPubMed CentralView Article
  23. Foley SL, Zhao S, Walker RD: Comparison of molecular typing methods for the differentiation of Salmonella foodborne pathogens. Foodborne Pathog Dis. 2007, 4: 253-276. 10.1089/fpd.2007.0085.PubMedView Article
  24. Multistate Outbreak of Salmonella Typhimurium and Salmonella Newport Infections Linked to Cantaloupe (Final Update). http://www.cdc.gov/salmonella/typhimurium-cantaloupe-08-12/index.html,
  25. Multistate Outbreak of Human Salmonella Heidelberg Infections Linked to “Kosher Broiled Chicken Livers” From Schreiber Processing Corporation. http://www.cdc.gov/salmonella/heidelberg-chickenlivers/index.html,
  26. Investigation Update: Multistate Outbreak of Human Salmonella Heidelberg Infections Linked to Ground Turkey. http://www.cdc.gov/salmonella/heidelberg/111011/index.html,
  27. Touchon M, Rocha EPC: The small, slow and specialized CRISPR and anti-CRISPR of Escherichia and Salmonella. PLoS ONE. 2010, 5: 14-View Article
  28. Bhaya D, Davison M, Barrangou R: CRISPR-Cas systems in bacteria and archaea: versatile small RNAs for adaptive defense and regulation. Annu Rev Genet. 2011, 45: 273-297. 10.1146/annurev-genet-110410-132430.PubMedView Article
  29. Andersson AF, Banfield JF: Virus population dynamics and acquired virus resistance in natural microbial communities. Science. 2008, 320: 1047-1050. 10.1126/science.1157358.PubMedView Article
  30. Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero DA, Horvath P: CRISPR provides acquired resistance against viruses in prokaryotes. Science. 2007, 315: 1709-1712. 10.1126/science.1138140.PubMedView Article
  31. Tyson GW, Banfield JF: Rapidly evolving CRISPRs implicated in acquired resistance of microorganisms to viruses. Environ Microbiol. 2008, 10: 200-207.PubMed
  32. Fabre L, Zhang J, Guigon G, Le Hello S, Guibert V, Accou-Demartin M, De Romans S, Lim C, Roux C, Passet V, Diancourt L, Guibourdenche M, Issenhuth-Jeanjean S, Achtman M, Brisse S, Sola C, Weill F-X: CRISPR typing and subtyping for improved laboratory surveillance of Salmonella infections. PLoS One. 2012, 7: e36995-10.1371/journal.pone.0036995.PubMedPubMed CentralView Article
  33. Liu F, Barrangou R, Gerner-Smidt P, Ribot EM, Knabel SJ, Dudley EG: Novel virulence gene and clustered regularly interspaced short palindromic repeat (CRISPR) multilocus sequence typing scheme for subtyping of the major serovars of Salmonella enterica subsp. enterica. Appl Environ Microbiol. 2011, 77: 1946-1956. 10.1128/AEM.02625-10.PubMedPubMed CentralView Article
  34. Shariat N, DiMarzio MJ, Yin S, Dettinger L, Sandt CH, Lute JR, Barrangou R, Dudley EG: The combination of CRISPR-MVLST and PFGE provides increased discriminatory power for differentiating human clinical isolates of Salmonella enterica subsp. enterica serovar Enteritidis. Food Microbiol. 2013, 34: 164-173. 10.1016/j.fm.2012.11.012.PubMedView Article
  35. Delannoy S, Beutin L, Burgos Y, Fach P: Specific detection of enteroaggregative hemorrhagic Escherichia coli O104:H4 strains by use of the CRISPR locus as a target for a diagnostic real-time PCR. J Clin Microbiol. 2012, 50: 3485-3492. 10.1128/JCM.01656-12.PubMedPubMed CentralView Article
  36. Delannoy S, Beutin L, Fach P: Use of clustered regularly interspaced short palindromic repeat sequence polymorphisms for specific detection of enterohemorrhagic Escherichia coli strains of serotypes O26:H11, O45:H2, O103:H2, O111:H8, O121:H19, O145:H28, and O157:H7 by real-time. J Clin Microbiol. 2012, 50: 4035-4040. 10.1128/JCM.02097-12.PubMedPubMed CentralView Article
  37. Hoe N, Nakashima K, Grigsby D, Pan X, Dou SJ, Naidich S, Garcia M, Kahn E, Bergmire-Sweat D, Musser JM: Rapid molecular genetic subtyping of serotype M1 group A Streptococcus strains. Emerg Infect Dis. 1999, 5: 254-263. 10.3201/eid0502.990210.PubMedPubMed CentralView Article
  38. Schouls LM, Reulen S, Duim B, Wagenaar JA, Willems RJL, Dingle KE, Colles FM, Van Embden JDA: Comparative genotyping of Campylobacter jejuni by amplified fragment length polymorphism, multilocus sequence typing, and short repeat sequencing: strain diversity, host range, and recombination. J Clin Microbiol. 2003, 41: 15-26. 10.1128/JCM.41.1.15-26.2003.PubMedPubMed CentralView Article
  39. Liu F, Kariyawasam S, Jayarao BM, Barrangou R, Gerner-Smidt P, Ribot EM, Knabel SJ, Dudley EG: Subtyping Salmonella enterica serovar enteritidis isolates from different sources by using sequence typing based on virulence genes and clustered regularly interspaced short palindromic repeats (CRISPRs). Appl Environ Microbiol. 2011, 77: 4520-4526. 10.1128/AEM.00468-11.PubMedPubMed CentralView Article
  40. DiMarzio MJ, Shariat N, Kariyawasam S, Barrangou R, Dudley EG: Antibiotic resistance in Salmonella Typhimurium associates with CRISPR sequence type. Antimicrob Agents Chemother. 2013, 57: 4282-4289. 10.1128/AAC.00913-13.PubMed CentralView Article
  41. Shariat N, Kirchner MK, Sandt CH, Trees E, Barrangou R, Dudley EG: CRISPR-MVLST subtyping of Salmonella serovar Newport outbreak isolates and determination of the relationship between CRISPR-MVLST and PFGE. J Clin Microbiol. 2013, 51: 2328-2336. 10.1128/JCM.00608-13.PubMedPubMed CentralView Article
  42. Struelens MJ: Consensus guidelines for appropriate use and evaluation of microbial epidemiologic typing systems. Clin Microbiol Infect. 1996, 2: 2-11. 10.1111/j.1469-0691.1996.tb00193.x.PubMedView Article
  43. Den Bakker HC, Moreno Switt AI, Cummings CA, Hoelzer K, Degoricija L, Rodriguez-Rivera LD, Wright EM, Fang R, Davis M, Root T, Schoonmaker-Bopp D, Musser KA, Villamil E, Waechter H, Kornstein L, Furtado MR, Wiedmann M: A whole-genome single nucleotide polymorphism-based approach to trace and identify outbreaks linked to a common Salmonella enterica subsp. enterica serovar Montevideo pulsed-field gel electrophoresis type. Appl Environ Microbiol. 2011, 77: 8648-8655. 10.1128/AEM.06538-11.PubMed CentralView Article
  44. Allard MW, Luo Y, Strain E, Li C, Keys CE, Son I, Stones R, Musser SM, Brown EW: High resolution clustering of Salmonella enterica serovar Montevideo strains using a next-generation sequencing approach. BMC Genomics. 2012, 13: 32-10.1186/1471-2164-13-32.PubMedPubMed CentralView Article
  45. Lienau EK, Strain E, Wang C, Zheng J, Ottesen AR, Keys CE, Hammack TS, Musser SM, Brown EW, Allard MW, Cao G, Meng J, Stones R: Identification of a salmonellosis outbreak by means of molecular sequencing. N Engl J Med. 2011, 364 (10): 981-982. 10.1056/NEJMc1100443.PubMedView Article
  46. Okoro CK, Kingsley RA, Quail MA, Kankwatira AM, Feasey NA, Parkhill J, Dougan G, Gordon MA: High-resolution single nucleotide polymorphism analysis distinguishes recrudescence and reinfection in recurrent invasive nontyphoidal Salmonella Typhimurium disease. Clin Infect Dis. 2012, 54: 955-963. 10.1093/cid/cir1032.PubMedPubMed CentralView Article
  47. Leekitcharoenphon P, Lukjancenko O, Friis C, Aarestrup FM, Ussery DW: Genomic variation in Salmonella enterica core genes for epidemiological typing. BMC Genomics. 2012, 13: 88-10.1186/1471-2164-13-88.PubMedPubMed CentralView Article
  48. Köser C, Ellington M, Cartwright E: Routine use of microbial whole genome sequencing in diagnostic and public health microbiology. PLoS Pathog. 2012, 8: e1002824-10.1371/journal.ppat.1002824.PubMedPubMed CentralView Article
  49. Kaldhone P, Nayak R, Lynne AM, David DE, McDermott PF, Logue CM, Foley SL: Characterization of Salmonella enterica serovar Heidelberg from turkey-associated sources. Appl Environ Microbiol. 2008, 74: 5038-5046. 10.1128/AEM.00409-08.PubMedPubMed CentralView Article
  50. Xi M, Zheng J, Zhao S, Brown EW, Meng J: An enhanced discriminatory pulsed-field gel electrophoresis scheme for subtyping Salmonella serotypes Heidelberg, Kentucky, SaintPaul, and Hadar. J Food Prot. 2008, 71: 2067-2072.PubMed
  51. Zheng J, Keys CE, Zhao S, Meng J, Brown EW: Enhanced subtyping scheme for Salmonella Enteritidis. Emerg Infect Dis. 2007, 13: 1932-1935. 10.3201/eid1312.070185.PubMedPubMed CentralView Article
  52. Hyytiä-Trees EK, Cooper K, Ribot EM, Gerner-Smidt P: Recent developments and future prospects in subtyping of foodborne bacterial pathogens. Future Microbiol. 2007, 2: 175-185. 10.2217/17460913.2.2.175.PubMedView Article
  53. Sandt CH, Krouse DA, Cook CR, Hackman AL, Chmielecki WA, Warren NG: The key role of pulsed-field gel electrophoresis in investigation of a large multiserotype and multistate food-borne outbreak of Salmonella infections centered in Pennsylvania. J Clin Microbiol. 2006, 44: 3208-3212. 10.1128/JCM.01404-06.PubMedPubMed CentralView Article
  54. Hunter PR, Gaston MA: Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. J Clin Microbiol. 1988, 26: 2465-2466.PubMedPubMed Central

Copyright

© Shariat et al.; licensee BioMed Central Ltd. 2013

This article is published under license to BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement