Open Access

Analysis for prevalence and physical linkages amongst integrons, ISEcp1, ISCR1, Tn21 and Tn7 encountered in Escherichia coli strains from hospitalized and non-hospitalized patients in Kenya during a 19-year period (1992–2011)

BMC Microbiology201313:109

DOI: 10.1186/1471-2180-13-109

Received: 24 September 2012

Accepted: 10 May 2013

Published: 17 May 2013

Abstract

Background

We determined the prevalence and evidence for physical linkage amongst integrons, insertion sequences, Tn21 and Tn7 transposons in a collection of 1327 E. coli obtained over a 19-year period from patients in Kenya.

Results

The prevalence of class 1 integrons was 35%, class 2 integrons were detected in 3 isolates but no isolate contained a class 3 integron. Integron lacking the 3’-CS or those linked to sul3 gene or IS26 or those containing the ISCR1 were only detected in multidrug resistant (MDR) strains. The dfrAs were the most common cassettes and their prevalence was: - dfrA1(28%), dfrA12(20%), dfA17(9%), dfrA7(9%), and dfrA16(5%). The aadA were the second most abundant cassettes and their prevalence was: - aadA1(25%), aadA2(21%), and aadA5(14%). Other cassettes occurred in lower prevalence of below 5%. Prevalence of Tn21, ISEcp1, ISCR1 and IS26 was 22%, 10%, 15%, and 7% respectively. Majority of Tn21 containing integrons carried a complete set of transposition genes while class 2 integrons were borne on Tn7 transposon. The qnrA genes were detected in 34(3%) isolates while 19(1%) carried qnrB. All qnr genes were in MDR strains carrying integrons containing the ISCR1. Close to 88% of blaTEM-52 were linked to IS26 while ≥ 80% of blaCTX-Ms and bla CMYs were linked to ISEcp1. Only a few studies have identified a blaCTX-M-9 containing an ISEcp1 element as reported in this study. Multiple genetic elements, especially those borne on incIl, incFII, and incL/M plasmids, and their associated resistance genes were transferrable en bloc to E. coli strain J53 in mating experiments.

Conclusions

This is the first detailed study on the prevalence of selected elements implicated in evolution of resistance determinants in a large collection of clinical E. coli in Africa. Proliferation of such strains carrying multiple resistance elements is likely to compromise the use of affordable and available treatment options for majority of poor patients in Africa. There is therefore a need to monitor the spread of these highly resistant strains in developing countries through proper infection control and appropriate use of antimicrobials.

Background

Recent studies conducted in Kenya show that a significant proportion of E. coli strains from clinical specimens exhibit a strong multi-drug resistance (MDR) phenotype [1, 2]. Fortunately, β-lactams, fluoroquinolones and aminoglycosides remain effective against a significant proportion of clinical E. coli strains in Kenya. However, recent studies have reported carriage of plasmid-borne aac(6')-lb-cr and qnr genes among β-lactamase producers [1, 2]. The qnr genes confer resistance to quinolones, while aac(6')-lb-cr confers reduced susceptibility to fluoroquinolones and aminoglycosides. Therefore, carbapenems remain some of the few alternative antimicrobials that are effective against strains harboring a combination of multiple β-lactamase (bla) genes and genes conferring broad-spectrum resistance to fluoroquinolones and aminoglycosides. Carbapenems may however not be readily available or affordable for many patients in Sub-Saharan Africa [3].

In a recent study, we reported carriage of integrons, IS elements, Tn21 and Tn7 in a collection of 27 E. coli strains obtained from hospitalised patients [1]. These strains also harbored conjugatively transferrable plasmids conferring resistance to β-lactams, fluoroquinolones, aminoglycosides and co-trimoxazole among other antimicrobials suggesting that genes encoding resistance to these antimicrobials are physically linked to each other. Carriage of physically linked elements, each containing a set of resistance genes, may increases the chances of en bloc horizontal transfer of multiple resistance determinants to susceptible strains. Carriage of multiple resistance elements may in turn confer unique advantages to the host and enable them survive a strong antimicrobial selection pressure especially in hospital settings [4].

Studies to determine the prevalence of resistance elements in a large collection of strains from Sub-Saharan Africa are still lacking. Furthermore, little is known on whether the genetic elements encountered among E. coli strains in this region are physically linked to each other. In this study, we determined the prevalence of integrons, ISEcp1, ISCR1, IS26 as well as transposons Tn21 and Tn7 in a collection of 1327 E. coli strains obtained from inpatient and outpatient populations seeking treatment in Kenyan hospitals during a 19-year period (1992–2011). We also determined genetic content of integrons and determined plasmid incompatibility groupings among strains exhibiting unique resistance phenotypes. Physical linkages among these elements and to bla genes were investigated using PCR methods. Similar analysis were done to determine if the aac(6')-lb-cr and qnr genes are physically linked to these elements.

Results

Antimicrobial susceptibility profiles

At least 25% of the 1327 isolates were resistant to expanded-spectrum β-lactams such as aztreonam (AZT), ceftriaxone (CRO), cefotaxime (CTX) and amoxicillin-clavulanic acid (AMC) combunation and to none-β-lactams such as streptomycin (S), nitrofurantoin (F), chloramphenicol (C), sulfamethoxazole (SUL), tetracyclines (TET) and trimethoprim (TRIM), Table 1. Resistance to a combination of two β-lactamase inhibitors, AMC and pipperacillin-tazobactam (TZP), was recorded in 22% of the isolates while 20% and 9% exhibited an ESBL- or an AmpC-like phenotype respectively, Table 2. A total of 106 strains were resistant to combinations of SUL, TRIM, ciprofloxacin (CIP), cefepime (FEP), gentamicin (CN), cefoxitin (FOX) and TZP. These isolates were therefore identified as strains with the highest potential to limit therapeutic option in clinical settings. Imipenem (IMI), cefepime FEP and CIP were effective against ≥ 90% of isolates. Strains from urine were more likely to exhibit an MDR phenotype compared to those from stool (p:0.0001, CI:27.2 to 84.8, OR:42) or blood (p:0.0001, CI:12.8 to 30.8, OR:19.9). Similarly, MDR phenotypes were more common among strains from hospitalized patients than those from non-hospitalized patients (p:0.0001, CI: 4.0 to 6.6, OR:5.1).
Table 1

Susceptibility profiles of isolates and their distribution in various specimen-types obtained from different categories of patients

   

Distribution [Number,%] of resistant strains in different specimen types

Distribution [Number,%] of resistant strains according to patient category

 

Number of resistant strains n = 1327

% of resistant strains

Stool n = 505

Urine n = 451

Blood n = 371

Inpatient n = 654

Outpatient n = 673

AMOX

756

57

225 (30)

355 (57)

176 (23)

439 (58)

318 (42)

AMP

809

61

253 (31)

373 (46)

184 (23)

518 (64)

292 (36)

AMC

478

36

143 (30)

249 (52)

86 (18)

329 (69)

148 (31)

AMS

544

41

153 (28)

288 (53)

103 (19)

343 (63)

201 (37)

TZP

279

21

85 (30)

141 (51)

53 (19)

226 (81)

53 (19)

AZT

385

29

121 (31)

191 (50)

73 (19)

258 (67)

127 (33)

CEF

411

31

121 (29)

256 (62)

34 (8)

234 (57)

177 (43)

CRO

358

27

97 (27)

184 (51)

78 (22)

266 (74)

93 (26)

CTX

372

28

102 (27)

197 (53)

73 (19)

290 (78)

82 (22)

CAZ

279

21

83 (30)

142 (51)

54 (19)

201 (72)

78 (28)

FEP

119

9

31 (26)

76 (64)

12 (10)

99 (83)

20 (17)

FOX

106

8

19 (18)

79 (74)

8 (6)

87 (82)

19 (18)

NA

239

18

86 (36)

132 (55)

21 (9)

163 (68)

77 (32)

CIP

106

8

19 (18)

79 (75)

8 (8)

65 (61)

41 (39)

STRP

491

37

145 (30)

271 (55)

75 (15)

290 (59)

201 (41)

K

305

23

85 (28)

167 (55)

53 (17)

195 (64)

110 (36)

CN

239

18

71 (30)

131 (54)

37 (16)

170 (71)

69 (29)

NEO

212

16

71 (34)

120 (56)

21 (10)

174 (82)

38 (18)

F

385

29

89 (23)

254 (66)

42 (11)

277 (72)

108 (28)

C

478

36

167 (35)

233 (49)

78 (16)

320 (67)

158 (33)

SUL

637

48

189 (30)

356 (56)

92 (14)

440 (69)

197 (31)

TET

703

53

218 (31)

353 (50)

132 (19)

478 (68)

225 (32)

TRIM

557

42

167 (30)

290 (52)

100 (18)

379 (68)

178 (32)

The distribution of resistant strains in different specimen-types obtained from inpatients and outpatients. The percentages are calculated based on the total number of strains resistant to a given antimicrobial in different specimen types and category of patients. AMOX: amoxicillin, AMP: ampicillin, AMC: amoxicillin-clavulanic acid, AMS: ampicillin-sulbactam, TZP: piperacillin-tazobactam, AZT: Aztreonam, CEF: cefuroxime, CRO: ceftriaxone, CTX: cefotaxime, CAZ: ceftazidime, FEP: cefepime, FOX: cefoxitin, NA: nalidixic acid, CIP: ciprofloxacin, STRP: streptomycin, K: kanamycin, CN: gentamicin, NEO: neomycin, F: nitrofurantoin, C: chloramphenicol, SUL: sulfamethoxazole, TET: Tetracylines, TRIM: Trimethoprim.

Table 2

Distribution of isolates exhibiting combined resistance to selected antimicrobials

 

Total isolates exhibiting a given phenotype

Stool

Urine

Blood

Inpatient

Outpatient

SUL, TRIM, CIP + CN + FEP + FOX + TZP and aminoglycosides a

106

30 (28)

57 (54)

19 (18)

87 (82)

19 (18)

F + SUL + TRIM + TET + Cb

451

121 (27)

233 (52)

97 (22)

322 (71)

129 (29)

AMC + AMSc

411

125 (30)

218 (53)

68 (17)

255 (62)

156 (38)

AMS + AMC + TZPc

291

87 (30)

172 (59)

32 (11)

194 (67)

97 (33)

ESBL strains

272

95 (35)

133 (49)

44 (16)

188 (69)

84 (31)

Isolates with an AmpC-like phenotype

122

38 (31)

72 (59)

12 (10)

93 (76)

29 (24)

Distribution of strains resistant to different combinations of antimicrobials among different specimen-types obtained from inpatient and outpatients. CIP: ciprofloxacin, CN: gentamicin, FEP: cefepime, FOX: cefoxitin, TET: tetracyclines, TZP: piperacillin-tazobactam, F: nitrofurantoin, SUL: sulfamethoxazole, TRIM: Trimethoprim, C: chloramphenicol, AMC: amoxicillin-clavulanic, AMS: ampicillin-sulbactam.

ESBL strains are susceptible to AMC and cephamycins but resistant to various combinations of cephalosporins while isolates with an AmpC-like phenotype are resistant to cephalosporins and cephamycins.

a: Isolates were resistant to at least one aminoglycoside.

b: These antimicrobials are relatively cheap and are readily available in developing countries.

c: Combinations of β-lactamase inhibitors that may be used to treat infections caused by strains that are resistant to β-lactams.

Prevalence of integrons and integron cassettes

Class 1 integrons were detected in 35% of all isolates, 3 isolates carried class 2 integrons but none tested positive for class 3 integrons. The dfrA sub-types conferring resistance to TRIM and the aadA-type cassettes conferring resistance to aminoglycosides were the most common cassettes in class 1 and 2 integrons, Table 3. The prevalence of cassettes encoding resistance to trimethoprim was: - dfrA1 (28%), dfrA12 (20%), dfA17 (9%), dfrA7(9%), and dfrA16 (5%), while that of aadA cassettes conferring resistance to aminoglycosides was as follows: - aadA1 (25%), aadA2 (21%), and aadA5 (14%). Despite a relatively high prevalence of resistance to β-lactams, only blaOXA-1 was identified as an integron cassette. While aadA and dfrA types were detected in strains exhibiting resistance to between 2 and 8 classes of antimicrobials, dfrB, aadA5, blaOXA-1, aac(6’)-lb-cr, and arr2 were detected only in strains resistant to at least 6 different classes of antimicrobials. Majority (78%) of dfrA17 were detected in strains resistant to multiple generations of β-lactams.
Table 3

Diversity of cassette arrays detected among class 1 and class 2 integrons

 

Distribution [number, (%)] of cassette arrays of cassette arrays in different types of integrons

 

Resistance to selected antimicrobials in randomly selected strains carrying a given integron array

Classes of antimicrobials to which the host strain was resistanta

Prevalence among isolates with integrons (n = 464)

Integrons containing 3’-CS

Integrons lacking 3’-CS

Class 1 integrons arrays

     

dfrA1

TRIM, SUL, TET,

2 to 4

60 (13)

53 (88)

7 (12)

dfrA1/aadA1

TRIM, STP, AMP, C, CTX, CAZ, CIP, NA

5 to 8

51 (11)

42 (82)

9 (18)

dfrA17/aadA5

TRIM, STP, C, AMP, C, CTX, CAZ, CIP, NA, FOX, AMC

5 to 8

42 (9)

34 (81)

8 (19)

dfrA7

TRIM, SMX, TET

2 to 8

42 (9)

35 (83)

7 (17)

aadA1

STP, C, TET, SUL

2 to 6

23 (5)

19 (83)

4 (17)

dfrA12/aadB

TRIM, STRP, CN, K, TOB, AMP, C, CTX, AMC

4 to 8

23 (5)

19 (83)

4 (17)

dfrA16/aadA2

TRIM, STP, K, TOB, AMP, C, CTX, AMC

6 to 8

23 (5)

22 (96)

1 (4)

aadA2/dfrA12

STP, TRIM, TET, C, SUL, AMP, CTX, AMC,

3 to 6

28 (6)

26 (93)

2 (7)

dfrA12/aadA2

TRIM, STP, TET, C, SUL

3 to 8

23 (5)

22 (96)

1 (4)

aadA5

STP, AMP, SUL, TET

7 to 8

23 (5)

22 (96)

1(4)

blaoxa-1/aadA1

STP, AMP, C, TET, CTX, CAZ, CIP, NA, FOX, AMC

8

23 (5)

22 (94)

1 (4)

blaoxa-1/aadA2

STP, AMP, C, TET, CTX, CAZ, CIP, NA, FOX, AMC

7 to 8

9 (2)

8 (88)

1 (12)

dfrA12/orfF/aadA2

TRIM, STP, C, TET, CTX, NA, AMC

6 to 8

9 (2)

8 (88)

1 (12)

aac(6')Ib/catB1/dfrA1

CN, TOB, C, TRIM, K, AMP, C, TET, CTX, CAZ, CIP, NA,

5 to 8

9 (2)

7 (78)

2 (22)

aadA1/dfrA1

STP, TRIM, AMP, C, TET, CTX, NA, AMC

3 to 8

9 (2)

9 (100)

0

aac(6')Ib/blaoxa-1/catB3/arr2

CN,TOB, K, C, RIF, AMP, C, TET, CTX, CAZ, CIP, NA, FOX, AMC

8

9 (2)

2 (22)

7 (78)

aadA2/orfF/dfrA12

STP, AMP, TRIM, SUL, TET

7 to 8

5 (1)

4 (80)

1 (20)

cmlA1

C,, TET, CTX, NA, AMP

3 to 8

3 (<1)

3 (100)

0

orf5/dfrB/orfA

TRIM, CN,TOB, C, AMP, C, TET, CTX, CAZ, CIP, NA, AMC

6

3 (<1)

0

3 (100)

dfrA12/aadA1/blaoxa1

TRIM, STP, CN,TOB, AMP, C, TET, CTX, CAZ, CIP, NA,

8

5 (1)

0

5 (100)

aac(6')-lb-cr

CN, K, TOB, C, AMP, C, TET, CTX, CAZ, CIP, NA, AMC

8

42 (9)

15 (36)

27 (64)

Class 2 Integron arrays

     

drfA1/sat2/aadA1

TRIM, STRP, CN, K, TOB, AMP, C, CTX, AMC

6 to 8

3 (<1)

NA

NA

The integron cassette arrays are indicated in the order they appear within class 1 and 2 integron variable cassette region (in the 5’-3’ orientation).

The resistance phenotype associated with a given array is indicated in bold.

a: Different antimicrobials tested in this study were conveniently grouped into 8 groups:- β-lactams and β-lactamase inhibitors, aminoglycosides, (fluoro)quinolones, nitrofurantoin, chloramphenicol, sulphonamides, trimethoprim, and tetracyclines.

b: These integrons carried a sul3 gene at the 3’-end or lacked this gene or 3’-CS comprising the qacEΔ1-sul1 genes.

The cmlA1 and aadA1/dfrA1 cassette arrays were only detected in integrons containing a 3’-CS. In contrast, at least 64% of aac(6')-lb-cr, dfrA12/aadA1/blaoxa1,orf5/dfrB/orfA, and aac(6')Ib/blaoxa-1/catB3/arr2 cassette arrays were detected in integrons lacking typical 3’-conserved sequences (3’-CS) that contains qacEΔ1 (a truncated gene encoding resistance to quaternary ammonium compounds, and sul1 encoding resistance to sulfonamides). All the three class 2 integrons contained an identical cassette array comprising dfrA1-sat2-aadA1.

Prevalence of Tn21, Tn7and IS elements

The prevalence of Tn21 was 22% while Tn7 was detected in 3 isolates that also carried class 2 integrons. Prevalence of ISEcp1, ISCR1 and IS26 was 10%, 15%, and 7% respectively. A high proportion (≥ 60%) of isolates containing the IS elements and integrons were MDR (resistant to at least 3 different classes of antimicrobials), Table 4. Isolates carrying multiple elements were more likely to exhibit an MDR phenotype than those lacking such elements (p:0.0001, CI:549.5 to 2419.6, OR:1153) and isolates from urine were more likely to harbor multiple elements compared to those from blood (p:0.0001, CI:3.1 to 5.5, OR:4.1) or those from stool (p:0.0008, CI:1.2 to 2.0, OR:1.6). Although integrons, IS elements and Tn21 were detected in isolates from all specimen-types, a high proportion (69%) of these elements were detected among strains from urine of hospitalized patients.
Table 4

Carriage of resistance genetic elements among 1327 E. coli exhibiting resistance to different classes of antimicrobials

 

Classes of antimicrobials to which host strains were resistanta

Combinations of genetic elements

Isolates positive for genetic elements

% among 1327 isolates

0

1 ≤ 2

3 ≤ 5

6-8

Integrons

464

35

0

37 (8)

65 (14)

362 (78)

ISCR1

199

15

0

0

18 (9)

181 (91)

ISEcp1

128

10

0

0

35 (27)

93 (73)

IS26

86

7

0

0

12 (14)

74 (86)

Tn21

289

22

0

18 (6)

33 (11)

238 (83)

Tn7

3

<1

0

0

1 (25)

2 (75)

Combination of genetic elements in same isolate

     

Integron + ISCR1 + Tn21

38

3

0

0

2 (5)

36 (95)

Integron + ISCR1 + IS26

28

2

0

0

2 (7)

26 (93)

Integron + ISCR1 + ISEcp1 + Tn21

16

1

0

0

0

16 (100)

No genetic element detected

332

35

307 (93)

25 (6)

0

0

Carriage of genetic elements or combination of elements among strains exhibiting resistance to different antimicrobials tested in this study. The antimicrobials were grouped into 8 convenient groups:- β-lactams and β-lactamase inhibitors, aminoglycosides, (fluoro)quinolones, nitrofurantoin, chloramphenicol, sulphonamides, trimethoprim, and tetracyclines.

Physical linkage amongst genetic elements

Figure 1 illustrates the strategy used for interrogation for physical linkages amongst genetic elements while Figure 2 illustrates some of the genetic associations identified in this study. Majority (69%) of integrons containing 3’-CS were physically linked to the Tn21 transposon while 75% of those containing a sul3 gene at the 3’-terminal were linked to IS26. This element was also linked to 80% of integrons lacking the 3’-CS, Table 5. Forty (40) isolates contained class 1 integrons linked to a single IS26 upstream the 5’-CS while in 12 isolates the integrons was flanked by two IS26 elements. All ISCR1 were detected only in MDR strains and were flanked by a pair of class 1 integron 3’-CS. Close to 94% of Tn21 that were linked to an integron contained a complete set of transposition genes (tnpA, tnpR and tnpM) while 89% of Tn21 with an incomplete set of these genes did not contain an integron, Table 6. All the three class 2 integrons were physically linked to Tn7.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2180-13-109/MediaObjects/12866_2012_Article_1981_Fig1_HTML.jpg
Figure 1

Schematic diagram showing some of the strategies for screening for various genetic elements and for interrogation between these elements and resistance genes. The targets of each primer and the direction of PCR amplification is shown using arrows. PCRs were done both in the 5’ and in the 3’ orientation for each pair of genes tested. A: The strategy used for detection and characterization of class 1 integrons. B: The strategy used for detection and characterization of class 2 integrons and their physical linkage to Tn7. C: An example of the strategy used for analysis of physical linkages between class 1 integrons and Tn21 and to IS26. The primer positions for screening of Tn21 transposition genes. D and E: An example of the strategy used for analysis for physical linkages between integrons, ISCR1 and bla genes. F: An example of the strategy used for analysis for physical linkages between integrons, ISEcp1, IS26 and bla genes. These illustrations are based on PCR mapping data and not sequencing. Therefore, the sizes of each gene and the distances between any two genes are not drawn to scale.

https://static-content.springer.com/image/art%3A10.1186%2F1471-2180-13-109/MediaObjects/12866_2012_Article_1981_Fig2_HTML.jpg
Figure 2

Schematic diagram illustrating examples of physical linkages amongst genetic elements and selected genes. 1a-1f: An example of physical linkages between bla genes and multiple genetic elements such as integrons, ISEcp1, and IS26. 2a-2b: An example of physical linkages between bla genes and ISEcp1. 3a-3d: An example of physical linkages between integrons and other genetic elements (such as the ISCR1 element) that are in turn linked to bla genes and (fluoro)quinolone resistant genes. 4a-4c: An example of physical linkages between Tn21 and integrons that are in turn be linked to IS elements. These illustrations are based on PCR mapping data and not sequencing. Therefore, the sizes of each gene and the distances between any two genes are not drawn to scale.

Table 5

Physical linkages between integrons and other genetic elements

  

Integrons (number,%) physically linked to different elements

Type of integrons

Total detected

Tn7

Tn21

ISCR1

ISEcp1

IS26

Class 1 integrons with 3‘-CS

375

3 (1)

257 (69)

199 (53)

19 (5)

4 (1)

Class 1 integron with sul3

64

0

12 (19)

0

12 (19)

48 (75)

Class 1 integrons lacking 3’-CS or Sul3

25

0

5 (20)

0

10 (40)

20 (80)

Class 2 integron

3

3 (100)

1 (33)

1 (33)

1 (33)

0

Carriage of Tn21, Tn7 and IS elements among strains carrying class 1 integrons. Carriage of other genetic elements among strains carrying class 2 integrons is also shown.

Table 6

Carriage of transposition genes among Tn 21 transposons

  

Number (%) of Tn21transposition gene combination

Category of Tn21

Number of Tn21detected

tnpA + tnpMonly

tnpR + tnpMonly

tnpM + tnpA + tnpR

Tn21 linked to integrons

156

0

9 (6)

147 (94)

Tn21 not linked to integrons

133

56 (42)

63 (47)

14 (11)

PCR methods were used for screening for three genes that are crucial for transposition of Tn21. The tnpA encodes a Tn21-like transposase, the tnpM encodes a putative transposition regulator. Integrons are incorporated into the Tn21 framework adjacent to the tnpM gene. The tnpR encodes a resolvase.

Physical linkages between resistance genes and genetic elements

Figure 2 illustrates selected examples of physical linkages between bla genes and different genetic elements. Over 40% of isolates carrying blaTEM-52, blaSHV-5 or blaCTX-M-14 were physically linked to the IS26, Table 7. The ISEcp1 was the most common IS element associated with blaCTX-M-14,bla CTX-M −15 and blaCMY-2. One isolate contained a blaCTX-M-9 linked to this element. In all cases, the ISEcp1 was detected upstream the bla gene, Figure 2.
Table 7

Analysis for physical association between bla genes and various genetic elements

  

Number (%) of β-lactamase physically linked to various genetic elements

β-lactamase genes

Number of isolates tested

IS26

ISEcp1

ISCR1

Integrons

bla SHV-1

60

23 (38)

12 (20)

10 (17)

9 (15)

bla OXA-1

43

12 (28)

21 (49)

32 (74)

36 (84)

bla OXA-2

17

0

2 (12)

5 (29)

3 (18)

bla SHV-5

18

10 (55)

5 (28)

3 (17)

1 (6)

bla SHV-12

19

7 (37)

4 (21)

3 (16)

2 (11)

bla CTX-M-1

9

1 (11)

0

2 (22)

1 (11)

bla CTX-M-3

15

6 (40)

0

0

0

bla CTX-M-8

6

2 (33)

1 (17)

0

0

bla CTX-M-9

3

0

1 (33)

3 (100)

0

bla CTX-M-14

25

10 (40)

3 (12)

5 (20)

3 (12)

bla CTX-M-15

32

4 (13)

30 (94)

0

0

bla TEM-103

18

2 (11)

0

1 (6)

1 (6)

bla TEM-109

9

0

0

0

0

bla TEM-50

10

2 (20)

1 (10)

6 (60)

3 (30)

bla TEM-52

37

29 (78)

1 (3)

3 (8)

2 (5)

bla TEM-78

9

2 (22)

0

3 (33)

2 (22)

bla TEM-125

36

3 (8)

0

3 (8)

2 (6)

bla TEM-152

14

1 (7)

0

4 (29)

2 (14)

bla TEM-158

10

1 (10)

0

0

0

bla CMY-2

48

12 (25)

42 (88)

12 (25)

3 (6)

Analysis for physical linkages between bla genes and various genetic elements. The bla content of the isolates analyzed had been determined in a past study [3].

Thirty seven (88%) of the 42 aac(6’)-lb-cr were borne on integrons containing the ISCR1 while 55% were borne on integrons linked to the IS26. Twenty four (71%) of the 34 isolates carrying a qnrA gene were resistant to nalidixic acid but not to ciprofloxacin while the other 10 isolates carrying this gene and 19 carrying the qnrB subtype were resistant to both antimicrobials, Table 8. None of the isolates tested positive for qnrS. Majority (87%) of qnr genes were physically linked to either integron-associated ISCR1 or the IS26. All Isolates carrying aac(6’)-lb-cr or the qnr genes contained multiple genetic elements and were all MDR.
Table 8

Carriage of aac(6')-lb-cr and qnr genes among strains containing genetic elements and bla genes

  

Number (%) of strains carrying each gene and number (%) of strains containing genes linked to genetic elements

Occurrence in strains carryingblagenesa

 

Total

Strains containingintI1

Linked tointI1

Strains containing IS26

Linked to IS26

Strains containing ISCR1

Linked to ISCR1

Strains containing ISEcp1

Linked to ISEcp1

β-lactamase negative strains

Strains containing TEM-1 or SHV-1 only

Strains containing broad-spectru>blagenes

aac(6’)-lb-cr

42

42 (100)

42 (100)

6 (14)

4 (9)

12 (29)

6 (14)

11 (26)

4 (10)

0

4 (9)

38 (91)

qnrA

34

27 (79)

26 (75)

11 (32)

4 (12)

28 (82)

23 (68)

8 (24)

1 (3)

0

2 (6)

32 (94)

qnrB

19

19 (100)

11 (58)

10 (53)

2 (11)

13 (64)

4 (21)

12 (63)

1 (5)

0

1 (5)

18 (95)

Table shows the number of isolates carrying the three (fluoro)quinolone resistance genes and the proportion of such strains in which these genes were physically linked to various genetic elements and to bla genes.

a: Distribution of the aac(6’)-lb-cr and qnr genes among strains fully susceptible to β-lactams, among those resistant to TEM-1 or SHV-1 with a narrow substrate-range and among those carrying genes encoding broad-spectrum β-lactamases such as blaSHV-5, blaSHV-12, bla CMY and bla CTX-Ms .

Conjugative plasmids mediate en bloctransfer of multiple elements and resistance genes

Multiple resistance genes and genetic elements associated with them were transferred en bloc to E. coli J53 in mating experiments, Table 9. Majority of such transferred were mediated by plasmids containing I1, L/M, XI, HI2 and the F-type replicons. These experiments further revealed that genes conferring resistance to tetracylines and chloramphenicol were also harbored in the same plasmids encoding resistance to β-lactams, (fluoro)quinolones and aminoglycosides. However, various gene combinations that had been determined to be physically linked using PCR could not be transferred in conjugation experiments using media containing different combinations of antimicrobials.
Table 9

Horizontal transfer of genetic elements and associated resistance genes from clinical strains (donors) to E. coli J53 (recipient)

Resistance profiles among donor and transconjugants

Resistance to selected antimicrobials among donors

Physically linked genetic elements or resistance genes detected in donors and recipients

Other genes whose linkages were not determined

Plasmid replicons detected

AMP, CTX, CAZ, FOX, NA, CIP, TET, C, AMC, K, CN, SUL

ISE cp 1/ bla CMY -2 /IS 26

aadA1, blaSHV-12

P, I1

AMP, CTX, CAZ, FOX, NA, CIP, TET, C, AMC, K, CN, SUL

IS 26 /ISE cp 1/b la CMY -2 , qnrA 1

Tn21, dfrA5, sul1

L/M

AMP, CTX, CAZ, NA, TET, C, AMC, K, CN, SUL, TRIM

IS 26 /ISE cp 1/ bla CTX-M -15

Tn21, dfrA 1, aac(6’)lb

FII, F, A/C

AMP, CTX, CAZ, NA, TET, C, AMC, K, CN, SUL, TRIM

IS26/ISEcp1/blaCTX-M-14

Tn21, aadA 5, sul 1, b laTEM-1

A/C, K, B/O

AMP, CTX, CAZ, NA, TET, C, AMC, K, CN, SUL, TRIM

IS 26 / bla CTX-M -3 /IS 26

aac(6’)lb, qnrB

FII, F

AMP, CTX, CAZ, NA, TET, C, AMC, K, CN, SUL, TRIM

IS 26 / bla TEM -52 / intI 1/ dfrA 1/ qacEΔ1/sul1

bla TEM-1

I1, FIB

AMP, CTX, CAZ, NA, CIP, TET, C, AMC, K, CN, SUL, TRIM

ISEcp1/bla CTX-M-15

dfrA 12, aadA 1, bla OXA -1 bla TEM -1 , sul 3

XI

AMP, CTX, CAZ, FOX, NA, CIP, TET, C, AMC, K, CN, SUL

ISE cp 1/ bla CMY -2 / intI 1/ aac(6')-lb-cr/ IS CR 1/ qnrA 1

aac(6’)lb, catB3, dfrA1

L/M, K

AMP, CTX, CAZ, NA, CIP, TET, C, AMC, K, CN, SUL, TRIM

intI1/dfrA16/aadA2/qacEΔ1/sul1/ISCR1/blaCTX-M-9

bla TEM-1 , bla SHV -5

L/M

AMP, CTX, CAZ, NA, CIP, TET, C, AMC, K, CN, SUL, TRIM

intI1/dfrA12/orfF/aadA2/qacEΔ1/sul1/ISCR1/qnrA/qacEΔ1/sul1

blaCTX-M-15, blaTEM-1, blaOXA-1

I1, FIB

AMP, CTX, CAZ, FOX, NA, CIP, TET, C, AMC, K, CN, SUL

intI 1/ aadA 2/q acEΔ1/ sul 1/IS CR 1/ bla CMY -2 / qacEΔ1/ sul 1/IS CR 1/

qnrA1,

I1, K, B/O

AMP, CTX, CAZ, NA, CIP, TET, C, AMC, K, CN, TRIM SUL

intI1/ aac(6')-lb-cr / qacEΔ1/ sul 1/ qnrA 1/ qacEΔ1/ sul 1

bla TEM -1 , bla SHV -5

FIA, FIB

AMP, CTX, NA, CIP, TET, C, AMC, K, CN, SUL, TRIM

Tn 21 / intI 1/ dfrA 5/IS 26

bla TEM-125

FIB, F, HI2

AMP, CTX, NA, CIP, TET, C, AMC, K, CN, SUL, TRIM

Tn 21 / intI 1/ dfrA 7/ qacEΔ1/ sul 1

bla CTX-M -8 ,

I1, F

AMP, CTX, CAZ, NA, CIP, TET, C, AMC, K, CN, SUL, TRIM

Tn 21 / intI 1/ dfrA1 / qacEΔ1/ sul 1

bla TEM-15 , bla TEM -1 , bla OXA -1 , aac(6')-lb-cr

FIB, HI2

Table shows carriage of genetic elements and selected genes conferring resistance to important classes of antimicrobials. The resistance phenotype and the genetic elements or genes transferred to the transconjugants are indicated in bold.

Discussion

The current study shows that a significant proportion of clinical E. coli strains in Kenyan are resistant to important classes of antimicrobials such as β-lactams, fluoroquinolones and aminoglycosides. These results are in agreement with those published before [1, 3, 5]. These MDR strains were however susceptible to carbapenems. It is easy (although illegal) to purchase antimicrobials in Kenya without prescriptions or with prescriptions not backed by laboratory investigations [6]. We hypothesize that such practices may directly or indirectly lead to emergence of highly resistant strains.

A high prevalence of MDR strains from urine and all specimens from hospitalized patients may reflects a corresponding heavy use of antimicrobials among this category of patients as reported in past studies [7, 8]. Majority of resistances encountered in hospital isolates were also encountered in community settings probably because patients are often discharged from hospitals as soon as their conditions improve, even before they complete their treatment regiments (our unpublished observations). It is therefore possible that hospital strains find their way into community settings and vis versa. However, we do not rule out the possibility that some MDR phenotypes may arise in community settings.

The high prevalence of class 1 integrons may partially be due to their association with the Tn21 that contain a complete set of transposition genes. Past studies show that dfrA7 and dfrA1 cassettes associated with Tn21-borne integrons are the most prevalent dfrA-subtypes in Central, North and Western Africa [912]. In this study however, the prevalence of dfrA7 was much lower than that of dfrA1, dfrA12 and dfA17 in that order. The class 2 integron dfrA1/sat2/aadA1 array reported in this study is globally distributed [13]. Our results may therefore reflect regional differences or similarities in distribution of integron cassette arrays. Such differences may arise from unique antimicrobial-use patterns in different countries. This study also demonstrates an apparent correlation between carriage of dfrA17 and resistance to multiple β-lactams as has been reported in Tunisia [12, 14] and from Northern Kenya among isolates from dog, cat and human specimens [5]. The reasons behind these correlations are yet to be elucidated. Carriage of different dfrA sub-types in our isolates and carriage of multiple integron-associated sul genes (sul1 and sul3) in the same isolate possibly correlates to heavy usage of sulfonamides and trimethoprim in Kenya for treatment of different infections and as prophylaxis against opportunistic infections among people with HIV/AIDS [1517].

Some integrons, especially those lacking the 3’-CS and those containing a sul3 at the 3’-end, were linked to the IS26 possibly because this element mediates deletion of 3’-CS in class 1 integrons 3’- terminal [18, 19]. Similar results have been published in Australia, Spain and Nigeria [11, 12, 18, 19]. Our data further suggest that strains carrying IS26-associated integrons are highly MDR probably because the IS26 is also linked to other non-integron genes such as β-lactamases.

Most β-lactamases, particularly those encoding CTX-M-14 and −15 and CMY-2, were physically linked to ISEcp1. Similar reports have been published in Tunisian [20, 21] but no ISEcp1 was detected upstream the bla-CTX-M-1 among our isolates as reported in a related study from the same country [22]. In one isolate, this element was found upstream the blaCTX-M-9. Reports of ISEcp1-blaCTX-M-9 linkages are rare but such linkages have been reported in Klebsiella pneumoniae isolates in Taiwan [23]. Majority of bla TEM genes, blaTEM-52 in particular, were physically linked to the IS26 as reported in Belgium and Germany [24, 25]. Taken together, these results suggest that most bla genes in our isolates are in similar genetic environments as those reported globally but the genetic environment of blaCTX-M-9 and blaCTX-M-1 in our isolates appears to be different from those reported globally.

Our results further demonstrated that most bla genes are distantly linked to elements that are in turn linked to other resistance genes such as aac(6’)-lb-cr and qnr. Similar reports have been published in Tunisia [20, 21] and in Nigeria [11]. ISEcp1, IS26 and ISCR1 are known to mediate transposition and/or expression of multiple resistance genes in their close proximity [2631]. Carriage of such multiple elements, each carrying a set of resistance genes may be responsible for the observed co-resistance to multiple antimicrobials among our isolates.

Conjugation experiments confirmed that multiple elements were borne on narrow host-range plasmids such as IncFII, IncH12 or on broad host-range plasmids such as IncL/M. The type of conjugative plasmids in our isolates (especially those carrying plasmids containing incF-type, incHI2 and incI1 incL/M replicons) were shown to confer resistances similar to those in strains from Tunisia, [32] and from two other studies conducted in Kenya [1, 5]. We hypothesis that plasmids of different incompatibility groups have acquired similar or identical sets of resistance genes and this acquisition is mediated by genetic elements such as those investigated in this study. Therefore, there is a possibility that such elements act as genetic shuttles between plasmids of different incompatibility grouping. The similarities and differences in genetic environments of bla, aac (6’)-lb-cr and qnr genes reported in this study may reflect a difference in transposition activities of such elements. We further hypothesize that differences in antibiotic use patterns in different regions influence the transposition activity of such elements.

Conclusions

This study reports carriage of multiple genetic elements in MDR E. coli strains and their association with selected resistance genes. Strains carrying such elements are likely to be well adapted to survive deleterious effects of combined antimicrobial therapy. Furthermore, such MDR strains have a potential to increase morbidity and mortality among patients. It is therefore important to launch surveillance programs and to put up measures to curtail the spread of these highly resistant strains. There is also a need to compare the genomes of strains encountered in Africa with those from other parts of the world.

Methods

Isolates

The 1327 non-duplicate isolates were obtained sequentially from 13 healthcare facilities in Kenya between 1992 and 2011 (19-year period) from 654 hospitalized and 673 non-hospitalized patients. These isolates comprised of 451 strains from patients with urethral tract infections (UTI) and those with urinary catheters while 371 were from blood of patients with septicemia. Another 505 strains were from fecal specimens of patients with loose stool, watery and bloody diarrhea. Only one isolate per specimen per patient was included for further analysis. Among the isolates investigated in this study, 912 had been analyzed for bla genes in a a past study [3] while 27 had been analyzed for selected genetic elements [1]. Ethical clearance to carry out this study was obtained from the KEMRI/National Ethics Committee (approval number SSC No. 1177).

Antimicrobial susceptibility profiles

Susceptibility profiles for all isolates were determined using antibiotic discs (Cypress diagnostics, Langdorp, Belgium) on Mueller Hinton agar (Oxoid, Louis, Mo. USA) using the Laboratory Standards Institute guidelines (CLSI) [33].

Detection of genetic elements

Figure 1 illustrates the strategy used for detection and characterization of integrons and transposons. Detection of class 1, 2 and 3 and determination of carriage of 3’-conserved sequences (3’-CS) in class 1 integrons was done as described before [34, 35]. Class 1 integron variable cassette region (VCR), the region in which the resistance gene cassettes are integrated, was amplified as previously described by Dalsgaard et al.[35] while that of class 2 integrons was amplified as described by White et al.[36]. The VCRs of integrons lacking the typical 3’-CS was determined using a PCR walking strategy published before [37]. Identification of integron cassette identity was done using a combination of restriction fragment length polymorphism (RFLP), sequencing and published bioinformatics tools [38, 39]. Detection of the ISEcp1, ISCR1, Tn21 and Tn7 elements was done as described in published studies [34, 35]. Analysis for Tn21 transposition genes:- tnpA, tnpR and tnpM genes was done as previously described by Pearson et al.[40]. The primers used in this study are presented in Table 10.
Table 10

Primers for screening for genetic elements and resistance genes and for analysis for physical linkages among such elements and selected resistance genes

Target Gene/region

Primer name

5'-3' sequence

Annealing Temperature

Expected product size (bp)

Gene accession Number

Integrons

     

intI1

INT-1 F

GTTCGGTCAAGGTTCTG

50

923

U12338

INT-1R

GCCAACTTTCAGCACATG

intI2

INT-2 F

ATGTCTAACAGTCCATTTT

50

450

AJ001816.1

INT-2R

AAATCTTTAACCCGCAAAC

intI3

INT3-F

GCAGGGTGTGGACGAATACG

57

760

AY219651

INT3-R

ACAGACCGAGAAGGCTTATG

3'-CS

qacED1

ATCGCAATAGTTGGCGAAGT

56

800

X15370

sul1-B

GCAAGGCGGAAACCCGCGCC

X12869

integron class 1 VCR

In-F

GGCATACAAGCAGCAAGC

52

Variable

U12338

In-B

AAGCAGACTTGACCTGAT

integron 2 VCR

hep74

CGGGATCCCGGACGGCATGCACGATTTGTA

55

Variable

EU780012

hep51

GATGCCATCGCAAGTACGAG

AJ002782

IS elements

     

ISEcp1

ISEcp1-F

GTT GCT CTG TGG ATA ACT TG

55

180

AJ242809

ISEcp1-R

CCT AAA TTC CAC GTG TGT

ISCR1

ISCR1-F

CGC CCA CTC AAA CAA ACG

55

469

L06418

ISCR1-R

GAG GCT TTG GTG TAA CCG

IS26

IS26-F

GCGGTAAATCGTGGAGTGAT

55

704

NC 007941.1

IS26-R

ATTCGGCAAGTTTTTGCTGT

Tn21 and Tn7

     

tnpM of Tn21

TnpM-F

TCAACCTGACGGCGGCGA

55

348

AF071413

TnpM-R

GGAGGTGGTAGCCGAGG

tnpR of Tn21

TnpR-F

GTC AGC AGC TTC GAC CAG AA

62

500

NC 002134.1

TnpR-R

GAG GTA CTG GTA GAG GGT TT

tnpA of Tn21

TnpA21-F

TGC GCT CCG GCG ACA TCT GG

62

1200

NC 002134.1

TnpA21-R

TCA GCC CGG CAT GCA CGC G

tnpA of Tn7

TnA7-F

CCCAGCAATAAAAGAGCTCATTGAGCAAGC

55

738

FJ914220.1

TnA7-R

TATCTAGAAACAGAGTGTCTTG

(fluoro)quinolone resistance genes

    

qnrA

qnrA-F

TTCAGCAAGAGGATTTCTCA

55

627

AY070235

qnrA-R

GGCAGCACTATTACTCCCAA

qnrB

qnrB-F

CCTGAGCGGCACTGAATTTAT

60

408

DQ351241

qnrB-R

GTTTGCTGCTCGCCAGTCGA

qnrS

qnrS-F

CAATCATACATATCGGCACC

60

641

AB187515

qnrS-R

TCAGGATAAACAACAATACCC

aac(6′)-Ib-cr

aac(6′)-Ib-cr-F

TTGCGATGCTCTATGAGTGGCTA

55

482

AAL93141.1

aac(6′)-Ib-cr-R

CTCGAATGCCTGGCGTGTTT

aac(6′)-Ib-cr (sequencing)

CGTCACTCCATACATTGCAA

 

bla genes

     

blaTEM

TEM-F

ATGAGTATTCAACAT TTC CG

55

840

EF125012

TEM-R

CCAATGCTTAATCAG TGA GG

blaSHV

SHV-F

TTCGCCTGTGTATTATCTCCCTG

50

854

AF148850

SHV-R

TTAGCGTTGCCAGTGYTCG

blaCTX-M

CTX-M-F

ATGTGCAGYACCAGTAARGTKATGGC

60

593

Y10278

CTX-m-R

TGGGTRAARTARGTSACCAGAAYCAGCGG

blaCMY

CMY-F

ATGATGAAAAAATCGTTATGC

55

1200

U77414

CMY-R

TTGCAGCTTTTCAAGAATGCGC

blaOXA-1

OXA-1 F

ATGAAAAACACAATACATATCAACTTCGC

62

820

JO2967

OXA-1R

GTGTGTTTAGAATGGTGATCGCATT

blaOXA-2

OXA-2 F

ACGATAGTTGTGGCAGACGAAC

62

602

AF300985

 

OXA-2R

ATYCTGTTTGGCGTATCRATATTC

   

Primers used for screening various genetic elements and for interrogating physical linkages between different genetic elements and between such elements and bla genes or (fluoro)quinolone resistance genes.

Y = T or C, R = G or A, S = G or C, K = G or T.

Detection of aac(6’)-lb-cr and qnrgenes

Screening for aac(6′)-Ib-cr gene that confers cross-resistance to fluoroquinolones and aminoglycoside was done using a combination of PCR, RFLP and sequencing as described by Park et al.[41]. The isolates were also screened for genes conferring resistance to quinolones: - qnrA, qnrB and qnrS using PCR and sequencing strategies previously described by Wu et al.[42].

Interrogation for physical linkages between genetic elements and resistance genes

Physical linkages between integron and the transposons were determined using a combination of published primers targeting 5’-conserved sequences (5’-CS) of class 1 integrons and those targeting the tnpM of Tn2 or those specific for tnpA7 of Tn7, Figure 1. A combination of primers targeting IS elements and those targeting the 5’-CS or the 3’-termini of integrons were used for interrogation for physical linkages between integrons and IS elements. A combination of primers specific for various genetic elements and consensus primers for bla SHV or blaTEM,[43, 44], bla CTX-M [45], bla CMY [46] and bla OXA [47, 48] were used for determination of physical linkages between bla genes and different genetic elements. Primers for aac(6’)-lb-cr and qnr genes were used in combination with those for different genetic elements to analyze for their physical association. A long-range polymerase [LongAmp® Taq DNA Polymerase, (New England Biolabs, USA)] was used in all reactions for physical linkages. A slow ramping rate of between 0.2°C/sec and 0.3°C/sec was set for the annealing step. The extension time was set at 72°C for 2 min and a final extension of 72°C for 15 min was carried out after 35–40 cycles of denaturation, annealing and extension.

Conjugation experiments

Conjugation experiments using sodium azide resistant E. coli strain J53 as the recipient were done as previous described [49]. Susceptibility to antimicrobials and determination of genetic element content of the transconjugants was determined using similar methods as those used for the corresponding donor strains. Plasmid incompatibility groupings were determined using the scheme of Carattoli et al.[50].

Statistical analysis

For the purpose of analysis, both intermediate and resistant results for antibiotic susceptibility testing were grouped together as “resistant”. Differences in proportion of isolates bearing different elements was analyzed using the Chi test (χ2) while the Fisher’s exact test was used for smaller sample sizes. The Odds Rations (OR) and the 95% confidence intervals (CIs) accompanying the χ2 tests were determined using the approximation of Woolf. The null hypothesis was rejected for values of p ≥ 0.05. Statistical analysis was performed using Statgraphics plus Version 5 (StatPoint Technologies, INC, Warrenton, VA, USA).

Authors’ information

JK and SK are research scientists at the Kenya Medical Research Institute (KEMRI). BMG is Professor at the K.U.Leuven (Faculty of Bioscience Engineering) while PB is a Senior Research Scientist at the Veterinary and Agrochemical Research Centre (VAR).

Declarations

Acknowledgements

The authors would like to thank staff and students attached to the CMR-WT unit lab at KEMRI and staff members of Bacteriology unit at VAR-Belgium. This work was supported by a PhD scholarship grant from the Vlaamse Interuniversitaire Raad (VLIR), Belgium (Grant number BBTP2007-0009-1086). This work is published with permission from the Director, KEMRI.

Authors’ Affiliations

(1)
Centre for Microbiology Research, Kenya Medical Research Institute
(2)
Department of Biosystems, Faculty of Bioscience Engineering, Katholieke Universiteit Leuven
(3)
Veterinary and Agrochemical Research Centre
(4)
Department of Pathology, Bacteriology and Poultry Diseases, Faculty of Veterinary Medicine, University of Ghent
(5)
Department of Virology, Parasitology and Immunology, Faculty of Veterinary Medicine, University of Ghent

References

  1. Kiiru J, Kariuki S, Goddeeris BM, Revathi G, Maina TW, Ndegwa DW, Muyodi J, Butaye P: Escherichia coli strains from Kenyan patients carrying conjugatively transferable broad-spectrum beta-lactamase, qnr, aac(6')-Ib-cr and 16S rRNA methyltransferase genes. J Antimicrob Chemother. 2011, 66: 1639-1642. 10.1093/jac/dkr149.PubMedView ArticleGoogle Scholar
  2. Kariuki S, Revathi G, Corkill J, Kiiru J, Mwituria J, Mirza N, Hart CA: Escherichia coli from community-acquired urinary tract infections resistant to fluoroquinolones and extended-spectrum beta-lactams. J Infect Dev Ctries. 2007, 1: 257-262.PubMedGoogle Scholar
  3. Kiiru J, Kariuki S, Goddeeris BM, Butaye P: Analysis of beta-lactamase phenotypes and carriage of selected beta-lactamase genes among Escherichia coli strains obtained from Kenyan patients during an 18-year period. BMC Microbiol. 2012, 12: 155-10.1186/1471-2180-12-155.PubMedPubMed CentralView ArticleGoogle Scholar
  4. Sabate M, Navarro F, Miro E, Campoy S, Mirelis B, Barbe J, Prats G: Novel complex sul1-type integron in Escherichia coli carrying bla(CTX-M-9). Antimicrob Agents Chemother. 2002, 46: 2656-2661. 10.1128/AAC.46.8.2656-2661.2002.PubMedPubMed CentralView ArticleGoogle Scholar
  5. Albrechtova K, Dolejska M, Cizek A, Tausova D, Klimes J, Bebora L, Literak I: Dogs of nomadic pastoralists in northern Kenya are reservoirs of plasmid-mediated cephalosporin- and quinolone-resistant Escherichia coli, including pandemic clone B2-O25-ST131. Antimicrob Agents Chemother. 2012, 56: 4013-4017. 10.1128/AAC.05859-11.PubMedPubMed CentralView ArticleGoogle Scholar
  6. Brooks JT, Shapiro RL, Kumar L, Wells JG, Phillips-Howard PA, Shi YP, Vulule JM, Hoekstra RM, Mintz E, Slutsker L: Epidemiology of sporadic bloody diarrhea in rural Western Kenya. Am J Trop Med Hyg. 2003, 68: 671-677.PubMedGoogle Scholar
  7. Blango MG, Mulvey MA: Persistence of uropathogenic Escherichia coli in the face of multiple antibiotics. Antimicrob Agents Chemother. 2010, 54: 1855-1863. 10.1128/AAC.00014-10.PubMedPubMed CentralView ArticleGoogle Scholar
  8. Bejon P, Mwangi I, Ngetsa C, Mwarumba S, Berkley JA, Lowe BS, Maitland K, Marsh K, English M, Scott JA: Invasive Gram-negative bacilli are frequently resistant to standard antibiotics for children admitted to hospital in Kilifi, Kenya. J Antimicrob Chemother. 2005, 56: 232-235. 10.1093/jac/dki145.PubMedView ArticleGoogle Scholar
  9. Frank T, Gautier V, Talarmin A, Bercion R, Arlet G: Characterization of sulphonamide resistance genes and class 1 integron gene cassettes in Enterobacteriaceae, Central African Republic (CAR). J Antimicrob Chemother. 2007, 59: 742-745. 10.1093/jac/dkl538.PubMedView ArticleGoogle Scholar
  10. Gassama A, Aidara-Kane A, Chainier D, Denis F, Ploy MC: Integron-associated antibiotic resistance in enteroaggregative and enteroinvasive Escherichia coli. Microb Drug Resist. 2004, 10: 27-30. 10.1089/107662904323047763.PubMedView ArticleGoogle Scholar
  11. Labar AS, Millman JS, Ruebush E, Opintan JA, Bishar RA, Aboderin AO, Newman MJ, Lamikanra A, Okeke IN: Regional dissemination of a trimethoprim-resistance gene cassette via a successful transposable element. PLoS One. 2012, 7: e38142-10.1371/journal.pone.0038142.PubMedPubMed CentralView ArticleGoogle Scholar
  12. Dahmen S, Mansour W, Boujaafar N, Arlet G, Bouallegue O: Distribution of cotrimoxazole resistance genes associated with class 1 integrons in clinical isolates of Enterobacteriaceae in a university hospital in Tunisia. Microb Drug Resist. 2010, 16: 43-47. 10.1089/mdr.2009.0091.PubMedView ArticleGoogle Scholar
  13. Goldstein C, Lee MD, Sanchez S, Hudson C, Phillips B, Register B, Grady M, Liebert C, Summers AO, White DG, Maurer JJ: Incidence of class 1 and 2 integrases in clinical and commensal bacteria from livestock, companion animals, and exotics. Antimicrob Agents Chemother. 2001, 45 (3): 723-726. 10.1128/AAC.45.3.723-726.2001.PubMedPubMed CentralView ArticleGoogle Scholar
  14. Ben SK, Jouini A, Ben SR, Somalo S, Saenz Y, Estepa V, Boudabous A, Torres C: Prevalence of broad-spectrum cephalosporin-resistant Escherichia coli isolates in food samples in Tunisia, and characterization of integrons and antimicrobial resistance mechanisms implicated. Int J Food Microbiol. 2010, 137: 281-286. 10.1016/j.ijfoodmicro.2009.12.003.View ArticleGoogle Scholar
  15. Grape M, Farra A, Kronvall G, Sundstrom L: Integrons and gene cassettes in clinical isolates of co-trimoxazole-resistant Gram-negative bacteria. Clin Microbiol Infect. 2005, 11: 185-192. 10.1111/j.1469-0691.2004.01059.x.PubMedView ArticleGoogle Scholar
  16. White PA, McIver CJ, Rawlinson WD: Integrons and gene cassettes in the enterobacteriaceae. Antimicrob Agents Chemother. 2001, 45: 2658-2661. 10.1128/AAC.45.9.2658-2661.2001.PubMedPubMed CentralView ArticleGoogle Scholar
  17. Bennett PM: Integrons and gene cassettes: a genetic construction kit for bacteria. J Antimicrob Chemother. 1999, 43 (1): 1-4. 10.1093/jac/43.1.1.PubMedView ArticleGoogle Scholar
  18. Curiao T, Canton R, Garcillan-Barcia MP, de la Cruz F, Baquero F, Coque TM: Association of composite IS26-sul3 elements with highly transmissible IncI1 plasmids in extended-spectrum-beta-lactamase-producing Escherichia coli clones from humans. Antimicrob Agents Chemother. 2011, 55: 2451-2457. 10.1128/AAC.01448-10.PubMedPubMed CentralView ArticleGoogle Scholar
  19. Dawes FE, Kuzevski A, Bettelheim KA, Hornitzky MA, Djordjevic SP, Walker MJ: Distribution of class 1 integrons with IS26-mediated deletions in their 3'-conserved segments in Escherichia coli of human and animal origin. PLoS One. 2010, 5: e12754-10.1371/journal.pone.0012754.PubMedPubMed CentralView ArticleGoogle Scholar
  20. Ben SK, Ben SR, Jouini A, Rachid S, Moussa L, Saenz Y, Estepa V, Somalo S, Boudabous A, Torres C: Diversity of genetic lineages among CTX-M-15 and CTX-M-14 producing Escherichia coli strains in a Tunisian hospital. Curr Microbiol. 2011, 62: 1794-1801. 10.1007/s00284-011-9930-4.View ArticleGoogle Scholar
  21. Jouini A, Ben SK, Vinue L, Ruiz E, Saenz Y, Somalo S, Klibi N, Zarazaga M, Ben MM, Boudabous A, Torres C: Detection of unrelated Escherichia coli strains harboring genes of CTX-M-15, OXA-1, and AAC(6')-Ib-cr enzymes in a Tunisian hospital and characterization of their integrons and virulence factors. J Chemother. 2010, 22: 318-323.PubMedView ArticleGoogle Scholar
  22. Ben SR, Ben SK, Estepa V, Jouini A, Gharsa H, Klibi N, Saenz Y, Ruiz-Larrea F, Boudabous A, Torres C: Prevalence and characterisation of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli isolates in healthy volunteers in Tunisia. Eur J Clin Microbiol Infect Dis. 2012, 31: 1511-1516. 10.1007/s10096-011-1471-z.View ArticleGoogle Scholar
  23. Ma L, Siu LK, Lu PL: Effect of spacer sequences between bla(CTX-M) and ISEcp1 on bla(CTX-M) expression. J Med Microbiol. 2011, 60: 1787-1792. 10.1099/jmm.0.033910-0.PubMedView ArticleGoogle Scholar
  24. Cullik A, Pfeifer Y, Prager R, von BH, Witte W: A novel IS26 structure surrounds blaCTX-M genes in different plasmids from German clinical Escherichia coli isolates. J Med Microbiol. 2010, 59: 580-587. 10.1099/jmm.0.016188-0.PubMedView ArticleGoogle Scholar
  25. Smet A, Van NF, Vandekerckhove TT, Martel A, Deforce D, Butaye P, Haesebrouck F: Complete nucleotide sequence of CTX-M-15-plasmids from clinical Escherichia coli isolates: insertional events of transposons and insertion sequences. PLoS One. 2010, 5: e11202-10.1371/journal.pone.0011202.PubMedPubMed CentralView ArticleGoogle Scholar
  26. Tavakoli N, Comanducci A, Dodd HM, Lett MC, Albiger B, Bennett P: IS1294, a DNA element that transposes by RC transposition. Plasmid. 2000, 44: 66-84. 10.1006/plas.1999.1460.PubMedView ArticleGoogle Scholar
  27. Toleman MA, Bennett PM, Walsh TR: ISCR elements: novel gene-capturing systems of the 21st century?. Microbiol Mol Biol Rev. 2006, 70 (2): 296-316. 10.1128/MMBR.00048-05.PubMedPubMed CentralView ArticleGoogle Scholar
  28. Bado I, Cordeiro NF, Robino L, Garcia-Fulgueiras V, Seija V, Bazet C, Gutkind G, Ayala JA, Vignoli R: Detection of class 1 and 2 integrons, extended-spectrum beta-lactamases and qnr alleles in enterobacterial isolates from the digestive tract of Intensive Care Unit inpatients. Int J Antimicrob Agents. 2010, 36: 453-458. 10.1016/j.ijantimicag.2010.06.042.PubMedView ArticleGoogle Scholar
  29. Xia R, Guo X, Zhang Y, Xu H: qnrVC-like gene located in a novel complex class 1 integron harboring the ISCR1 element in an Aeromonas punctata strain from an aquatic environment in Shandong Province, China. Antimicrob Agents Chemother. 2010, 54: 3471-3474. 10.1128/AAC.01668-09.PubMedPubMed CentralView ArticleGoogle Scholar
  30. Bonnet R: Growing group of extended-spectrum beta-lactamases: the CTX-M enzymes. Antimicrob Agents Chemother. 2004, 48: 1-14. 10.1128/AAC.48.1.1-14.2004.PubMedPubMed CentralView ArticleGoogle Scholar
  31. Poirel L, Lartigue MF, Decousser JW, Nordmann P: ISEcp1B-mediated transposition of blaCTX-M in Escherichia coli. Antimicrob Agents Chemother. 2005, 49 (1): 447-450. 10.1128/AAC.49.1.447-450.2005.PubMedPubMed CentralView ArticleGoogle Scholar
  32. Zucker JR, Lackritz EM, Ruebush TK, Hightower AW, Adungosi JE, Were JB, Metchock B, Patrick E, Campbell CC: Childhood mortality during and after hospitalization in western Kenya: effect of malaria treatment regimens. Am J Trop Med Hyg. 1996, 55: 655-660.PubMedGoogle Scholar
  33. Clinical and Laboratory Standards Institute: Performance standards for antimicrobial susceptibility testing. Sixteenth informational supplement M100-S16. 2006, Wayne, PA: Clinical and Laboratory Standards InstituteGoogle Scholar
  34. Shi L, Fujihara K, Sato T, Ito H, Garg P, Chakrabarty R, Ramamurthy T, Nair GB, Takeda Y, Yamasaki S: Distribution and characterization of integrons in various serogroups of Vibrio cholerae strains isolated from diarrhoeal patients between 1992 and 2000 in Kolkata, India. J Med Microbiol. 2006, 55: 575-583. 10.1099/jmm.0.46339-0.PubMedView ArticleGoogle Scholar
  35. Dalsgaard A, Forslund A, Serichantalergs O, Sandvang D: Distribution and content of class 1 integrons in different Vibrio cholerae O-serotype strains isolated in Thailand. Antimicrob Agents Chemother. 2000, 44: 1315-1321. 10.1128/AAC.44.5.1315-1321.2000.PubMedPubMed CentralView ArticleGoogle Scholar
  36. White DG, Zhao S, Simjee S, Wagner DD, McDermott PF: Antimicrobial resistance of foodborne pathogens. Microbes Infect. 2002, 4: 405-412. 10.1016/S1286-4579(02)01554-X.PubMedView ArticleGoogle Scholar
  37. Saenz Y, Vinue L, Ruiz E, Somalo S, Martinez S, Rojo-Bezares B, Zarazaga M, Torres C: Class 1 integrons lacking qacEDelta1 and sul1 genes in Escherichia coli isolates of food, animal and human origins. Vet Microbiol. 2010, 144: 493-497. 10.1016/j.vetmic.2010.01.026.PubMedView ArticleGoogle Scholar
  38. Yu HS, Lee JC, Kang HY, Jeong YS, Lee EY, Choi CH, Tae SH, Lee YC, Seol SY, Cho DT: Prevalence of dfr genes associated with integrons and dissemination of dfrA17 among urinary isolates of Escherichia coli in Korea. J Antimicrob Chemother. 2004, 53: 445-450. 10.1093/jac/dkh097.PubMedView ArticleGoogle Scholar
  39. Thompson JD, Higgins DG, Gibson TJ: CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22: 4673-4680. 10.1093/nar/22.22.4673.PubMedPubMed CentralView ArticleGoogle Scholar
  40. Pearson AJ, Bruce KD, Osborn AM, Ritchie DA, Strike P: Distribution of class II transposase and resolvase genes in soil bacteria and their association with mer genes. Appl Environ Microbiol. 1996, 62: 2961-2965.PubMedPubMed CentralGoogle Scholar
  41. Park CH, Robicsek A, Jacoby GA, Sahm D, Hooper DC: Prevalence in the United States of aac(6')-Ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob Agents Chemother. 2006, 50 (11): 3953-3955. 10.1128/AAC.00915-06.PubMedPubMed CentralView ArticleGoogle Scholar
  42. Wu JJ, Ko WC, Wu HM, Yan JJ: Prevalence of Qnr determinants among bloodstream isolates of Escherichia coli and Klebsiella pneumoniae in a Taiwanese hospital, 1999–2005. J Antimicrob Chemother. 2008, 61 (6): 1234-1239. 10.1093/jac/dkn111.PubMedView ArticleGoogle Scholar
  43. Arlet G, Rouveau M, Philippon A: Substitution of alanine for aspartate at position 179 in the SHV-6 extended-spectrum beta-lactamase. FEMS Microbiol Lett. 1997, 152 (1): 163-167. 10.1016/S0378-1097(97)00196-1.PubMedView ArticleGoogle Scholar
  44. Arlet G, Brami G, Decre D, Flippo A, Gaillot O, Lagrange PH, Philippon A: Molecular characterisation by PCR-restriction fragment length polymorphism of TEM beta-lactamases. FEMS Microbiol Lett. 1995, 134: 203-208.PubMedGoogle Scholar
  45. Lartigue MF, Poirel L, Nordmann P: Diversity of genetic environment of bla(CTX-M) genes. FEMS Microbiol Lett. 2004, 234 (2): 201-207. 10.1111/j.1574-6968.2004.tb09534.x.PubMedView ArticleGoogle Scholar
  46. Winokur PL, Brueggemann A, DeSalvo DL, Hoffmann L, Apley MD, Uhlenhopp EK, Pfaller MA, Doern GV: Animal and human multidrug-resistant, cephalosporin-resistant salmonella isolates expressing a plasmid-mediated CMY-2 AmpC beta-lactamase. Antimicrob Agents Chemother. 2000, 44: 2777-2783. 10.1128/AAC.44.10.2777-2783.2000.PubMedPubMed CentralView ArticleGoogle Scholar
  47. Olesen I, Hasman H, Aarestrup FM: Prevalence of beta-lactamases among ampicillin-resistant Escherichia coli and Salmonella isolated from food animals in Denmark. Microb Drug Resist. 2004, 10 (4): 334-340. 10.1089/mdr.2004.10.334.PubMedView ArticleGoogle Scholar
  48. Hasman H, Mevius D, Veldman K, Olesen I, Aarestrup FM: beta-Lactamases among extended-spectrum beta-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J Antimicrob Chemother. 2005, 56: 115-121. 10.1093/jac/dki190.PubMedView ArticleGoogle Scholar
  49. Jeong JY, Yoon HJ, Kim ES, Lee Y, Choi SH, Kim NJ, Woo JH, Kim YS: Detection of qnr in clinical isolates of Escherichia coli from Korea. Antimicrob Agents Chemother. 2005, 49 (6): 2522-2524. 10.1128/AAC.49.6.2522-2524.2005.PubMedPubMed CentralView ArticleGoogle Scholar
  50. Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL, Threlfall EJ: Identification of plasmids by PCR-based replicon typing. J Microbiol Methods. 2005, 63 (3): 219-228. 10.1016/j.mimet.2005.03.018.PubMedView ArticleGoogle Scholar

Copyright

© Kiiru et al.; licensee BioMed Central Ltd. 2013

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.