Open Access

Genes and pathways for CO2 fixation in the obligate, chemolithoautotrophic acidophile, Acidithiobacillus ferrooxidans, Carbon fixation in A. ferrooxidans

  • Mario Esparza1, 4,
  • Juan Pablo Cárdenas1,
  • Botho Bowien3,
  • Eugenia Jedlicki2 and
  • David S Holmes1Email author
BMC Microbiology201010:229

DOI: 10.1186/1471-2180-10-229

Received: 4 March 2010

Accepted: 27 August 2010

Published: 27 August 2010

Abstract

Background

Acidithiobacillus ferrooxidans is chemolithoautotrophic γ-proteobacterium that thrives at extremely low pH (pH 1-2). Although a substantial amount of information is available regarding CO2 uptake and fixation in a variety of facultative autotrophs, less is known about the processes in obligate autotrophs, especially those living in extremely acidic conditions, prompting the present study.

Results

Four gene clusters (termed cbb1-4) in the A. ferrooxidans genome are predicted to encode enzymes and structural proteins involved in carbon assimilation via the Calvin-Benson-Bassham (CBB) cycle including form I of ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO, EC 4.1.1.39) and the CO2-concentrating carboxysomes. RT-PCR experiments demonstrated that each gene cluster is a single transcriptional unit and thus is an operon. Operon cbb1 is divergently transcribed from a gene, cbbR, encoding the LysR-type transcriptional regulator CbbR that has been shown in many organisms to regulate the expression of RubisCO genes. Sigma70-like -10 and -35 promoter boxes and potential CbbR-binding sites (T-N11-A/TNA-N7TNA) were predicted in the upstream regions of the four operons. Electrophoretic mobility shift assays (EMSAs) confirmed that purified CbbR is able to bind to the upstream regions of the cbb1, cbb2 and cbb3 operons, demonstrating that the predicted CbbR-binding sites are functional in vitro. However, CbbR failed to bind the upstream region of the cbb4 operon that contains cbbP, encoding phosphoribulokinase (EC 2.7.1.19). Thus, other factors not present in the assay may be required for binding or the region lacks a functional CbbR-binding site. The cbb3 operon contains genes predicted to encode anthranilate synthase components I and II, catalyzing the formation of anthranilate and pyruvate from chorismate. This suggests a novel regulatory connection between CO2 fixation and tryptophan biosynthesis. The presence of a form II RubisCO could promote the ability of A. ferrooxidans to fix CO2 at different concentrations of CO2.

Conclusions

A. ferrooxidans has features of cbb gene organization for CO2-assimilating functions that are characteristic of obligate chemolithoautotrophs and distinguish this group from facultative autotrophs. The most conspicuous difference is a separate operon for the cbbP gene. It is hypothesized that this organization may provide greater flexibility in the regulation of expression of genes involved in inorganic carbon assimilation.

Background

Acidithiobacillus ferrooxidans is a mesophilic, obligately chemolithoautotrophic, γ-proteobacterium that gains energy and reducing power from the oxidation of ferrous iron and reduced inorganic sulfur compounds (RISCs) [1]. It grows optimally at pH 2, although growth as low as pH 1 has been reported [2]. The microorganism is a key player in the solubilization of copper in industrial bioleaching operations and makes an important contribution to the biogeochemical cycling of nutrients and metals in pristine and manmade acidic environments. In such environments, CO2 would be expected to exist preferentially as a dissolved gas in equilibrium with the atmosphere and not in the bicarbonate form typically found at circum-neutral pHs [3].

A. ferrooxidans has previously been shown [4, 5] to have candidate genes (cbbL and cbbS) for the large and small subunits of ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO, EC 4.1.1.39) that catalyses CO2 fixation by the Calvin-Benson-Bassham (CBB) cycle in many organisms [6]. cbbL and cbbS are linked to genes predicted to encode carboxysome shell proteins [7] and a divergently transcribed gene encoding the LysR-type transcription regulator CbbR [4]. The intergenic region between cbbR and cbbL is predicted to harbor binding sites for CbbR [4]. In addition, microarray transcript profiling experiments have detected differential expression of several genes in A. ferrooxidans potentially involved in the CBB cycle depending on the growth substrate used [8].

These observations taken together, suggest that, in A. ferrooxidans, CbbR can regulate the expression of RubisCO and the carboxysome genes and therefore is likely to be involved in the regulation of carbon fixation as has been observed in other autotrophic bacteria including: Xanthobacter flavus[9], Ralstonia eutropha H16 [10], Chromatium vinosum[11], Nitrobacter vulgaris[12], Halothiobacillus neapolitanus[13], Thiobacillus denitrificans[14], Rhodobacter sphaeroides[15], Rhodobacter capsulatus[16], Rhodospirillum rubrum[17], Hydrogenovibrio marinus[18], Nitrosomonas europaea[19] and Thiomicrospira crunogena XCL-2 [20]. However, no coherent model has been developed for A. ferrooxidans to explain all the data and little experimental evidence has been provided to support several of the aforementioned observations, prompting the current investigation.

Methods

Bacterial strains and culture conditions

Information regarding bacterial strains and plasmids used in this study is provided in Table 1. A. ferrooxidans was cultured in 9 K medium (adjusted to pH 3.5 with H2SO4) containing 5 g/l elemental sulfur at 30°C under aerobic conditions on a rotary shaker at 150 rpm as described previously [21]. Escherichia coli harboring plasmids was grown at 37°C in LB broth with ampicillin (Amp: 100 μg/ml).
Table 1

List of bacterial strains and plasmids used in this study

Strain or plasmid

Relevant characteristic

Source or reference

Bacterial strains

  

Acidithiobacillus

ferrooxidans

Type strain

ATCC 23270

E. coli TOP10

F- mcr A Δ(mrr-hsd RMS-mcr BC) ϕ80lac ZΔM15 Δlac X74 rec A1 ara D139 Δ(ara-leu) 7697 gal U gal K rps L (StrR) end A1 nup G

Invitrogen

Plasmids

  

pBAD-TOPO®

AmpR promoter ara BAD (PBAD) C-terminal: V5 epitope tag-polyhistidine (6 × His)

Invitrogen

pBAD-cbb R

pBAD-TOPO::927-bp fragment containing cbb R from A. ferrooxidans ATCC 23270 expressed from PBAD promoter

This study

Abbreviations used: ATCC, American Type Culture Collection. AmpR, ampicillin resistance; StrR, streptomycin resistance.

General DNA techniques and sequencing of DNA

A. ferrooxidans cultures were centrifuged at 800 × g to remove solid sulfur precipitates prior to cell harvest. Unattached cells were pelleted at 8000 × g for 10 min. The cell pellet was resuspended in 9 K salt solution for washing and washed cells were collected by centrifugation at 8000 × g for 10 min as described previously [21]. Standard procedures [22] were employed to isolate genomic and plasmid DNA from bacteria, to transform plasmid DNA into E. coli, and for general DNA handling. Restriction endonucleases and DNA-modifying enzymes were used as recommended by the manufacturers. Plasmid DNA was prepared by means of the QIAprep Spin Mini Kit (Qiagen). Polymerase chain reaction (PCR) products were amplified with Taq DNA polymerase (Fermentas) and purified from agarose gels using the QiaEx DNA Purification Kit (Qiagen). Each PCR reaction contained in a volume of 25 μl 1 ng of template DNA, 0.5 μM of required primers and 0.2 mM of each deoxyribonucleotide in 1× PCR buffer containing 1.5 mM MgCl2 (Fermentas). PCR conditions were as follows: initial denaturing step at 95°C for 5 min followed by 30 amplification cycles (denaturation at 95°C for 30 s, annealing at the appropriate temperature depending on the specific primer pairs for 20 s, elongation at 72°C) and a final elongation step at 72°C for 10 min. DNA sequencing of pBAD-cbbR was carried out by the Göttingen Genomics Laboratory (Göttingen, Germany).

Isolation of RNA and RT-PCR

Total RNA was isolated from cells of A. ferrooxidans grown to mid-log phase in 9 K medium supplemented with sulfur, as described previously [23]. The RNA preparation was treated with DNase I (Fermentas) before proceeding with the cDNA synthesis step. One microgram of total cellular RNA was used for each reaction. Reverse transcription-PCR (RT-PCR) was performed on purified RNA using the One-Step RT-PCR kit (Qiagen). The sequences of the RT and PCR primers used are provided in Table 2. As controls, reactions were carried out that included RNA but lacked reverse transcriptase to assess genomic DNA contamination and that lacked RNA but contained 1 ng of genomic DNA.
Table 2

Sequences of primers used in co-transcription RT-PCR assays, cloning experiments and EMSA assays.

Primers used in RT-PCR assays

cbb1 operon

Numbera

Gene

Forward primer (5'-3')

Numbera

Gene

Reverse primer (5'-3')

1

cbbR

CAACGCCGTGTTGCTCGAA

2

cbbL1

CTAGACTTTTTTACGGCCATGCTT

3

cbbL1

CTGCCAATCGTGTCGCGC

4

csoS2

CGCACGGGAAAGCGACTT

5

csoS2

CCTATGGTGCCGTGCCAAC

6

csoS3

GTGCATGACGCACGCCC

7

csoS3

GTCAGCGGGTCAAAGCCG

8

csoS1A

GCCGCCTTGGTCATCG

9

csoS1B

GGAGCAGATGCGTGTGAGCG

11

parA

AGTAGAACCCCGCCGAGCCAA

10

bfrA

CGCGCAGAAGAGTTACAAGCCTTG

12

parA

CTGATCGAACCCTGAGGATCGG

13

parA

GTGCTGCGGTTGAAGGGGT

14

hyp2

GTGGAGTTCGATAATGGCGGAG

15

hyp2

CGAGAAGCCTCCGCCATTATC

16

cbbQ1

GCCTGTGGGTCCTTTCAGCAT

18

cbbO1

TGACGCCAGGAAAGCGGTG

17

cbbO1

CAGGGATTTCAGGCTGGTCG

19

cbbO1

GCAGAGGCTGCCAGAAAAGCT

20

cbbA

AAGCACCTACCGCGTATCCGT

   

21

bioD a

CAGTGCCACCGCCACCC

cbb2 operon

 

Forward primer (5'-3')'

 

Reverse primer (5'-3')

 

1

tatC a

ACGACGGCGTCTAGAACCGCC

2

cbbL2

CCGGTAATCCTCTAGACCCGCGTT

3

cbbL2

CATCGAGAAGGAAGGCAAGGC

4

cbbS2

CGCAACCTGTTGACGGATCTG

5

cbbS2

ACCGGAAAACGCCTTCGGC

6

cbbQ2

GGTCAATGGGCCATCCTGCC

7

cbbQ2

AGGGTGTTGAGGCGAAGGCC

8

cbbO2

GTACGATGGGCGTGTGCGC

9

cbbO2

GCCTACAGCGAGGAGGCCATG

10

yfeA a

GCGGAGCCTTGTCCCTCGG

cbb3 operon

  

Forward primer (5'-3')'

  

Reverse primer (5'-3')

1

hyp4 a

TACGAAGGCGGCTCCCCG

2

hyp3

CGACGGCAATCGGAGTCTTT

3

hyp3

CGGGTGATCGCGCTGGAT

4

cbbT

CAGAATGCCGTCGTGACCA

5

cbbT

ATCGGCATCGACCACTTT

6

cbbK

TCCATCATACGCAGGACA

7

cbbK

CCTACATCAGTACGGGTG

9

cbbA

CACCTGCTCCAGGTTGTT

8

pykA

TTGATCCTCATCACCATCGG

11

cbbE

GATATGGATATAGTCGGCACCC

10

cbbA

GCAGGCCAGCAAGATCAA

14

trpE

GCCGACAAGGGAGTATCGA

12

cbbE

CTATCGAACTGGAAGTGGATGG

16

trpG

CGATAGCCGCCACGTCG

13

cbbZ

TCGGCGATTCACGTAACG

17

trpC a

AGGGCCACTGCCGCCTGC

15

trpE

GAAACCATGAACAAACGCCG

   

cbb4 operon

  

Forward primer (5'-3')'

  

Reverse primer (5'-3')

1

ompA a

GGTATTTCCTATTTTTGGGGTGGC

3

sahA

CGGCAATGCGGACTTCCTTAC

2

metK

TTGGGAGCGGACCGACAAG

5

metF

AAGCATACTCGGGACCCAAGG

4

sahA

CTTCGCGGGGGTGCTGA

7

cbbP

GACGGGATGTTTTTTGGACATGG

6

metF

CACCGAGCCTGCATTTTTACACC

9

ynbD

GGCTACAGCCACCACGGGAT

8

cbbP

ATGTTGCCGGGCAGTTTTATGTC

10

fbnA a

GCGAGGTGGACTGGACGGA

Primers used in EMSA assays and cloning experiments

Letter designation

Forward primer (5'-3')

 

Reverse primer (5'-3')

(a) Pcbb1

CGGCAGCGAAGATCTTGAGTTGGTGC

(b) Pcbb1

CTCCGGCCTCATACTTTTTTACGG

(c) cbbRfw

TCTATCCGTCATGCAACCTTG

(d) cbbRrev

GCGCCATTCCTTTTCACCATG

(e) Pcbb2

ACGACGGCGGCAAGCACCGCC

(f) Pcbb2

CCGGTAATCCTTCACACCCGCGTT

(g) Pcbb3

CATTGAACAGGGTCAGCTCCTGG

(h) Pcbb3

ATCGGAGTCTTTGATCATGCGCC

(i) Pcbb4

TTTGGGGTGGCAGCAAGAAGT

(j) Pcbb4

GGAAACGGATTCAGAGGTGAAAAG

aGenes lie outside the operons and are not shown in Figure 2.

Cloning and expression of cbbR

A DNA fragment corresponding to the coding region of cbbR of A. ferrooxidans was amplified by PCR using primers (Integrated DNA Technologies) cbbRfw and cbbRrev (Table 2). The amplified product was cloned into the expression vector pBAD-TOPO (Invitrogen) according to the manufacturer's instruction. The resulting plasmid pBAD-cbbR was introduced by electroporation into E. coli TOP10 (Invitrogen) competent cells [22]. E. coli was grown at 37°C in 10 ml LB containing 100 μg/ml ampicillin to an OD600 of 0.8. Overproduction of the recombinant His6-tagged CbbR protein was initiated by adding arabinose to a final concentration of 0.1% (w/v) with continued shaking at 200 rpm for 12 h.

Purification of CbbR

Cells from 1.5 l of induced culture were harvested by centrifugation (8,000 × g for 10 min at 4°C) and at -20°C. After thawing the cell pellet was resuspended in 40 ml denaturing buffer containing 6 M guanidine-HCl, 100 mM NaH2PO4 and 10 mM Tris-HCl, pH 8.0, and incubated at room temperature with continuous stirring for about 30 min until inclusion body proteins were solubilized. Any remaining insoluble material was removed by centrifugation at 18,000 × g and 7°C for 20 min. The resulting supernatant was filtered through a 0.45-μm membrane and the recombinant protein subsequently purified by affinity chromatography on a 2.5-ml Ni-nitrilotriacetic acid column under amalgam conditions (denaturing conditions-native conditions). Initially the protein was adsorbed to the matrix under denaturing conditions at room temperature after equilibration with binding denaturing buffer (BDB) containing 8 M urea, 100 mM NaH2PO4 and 10 mM Tris-HCl, pH 8.0. The column was first washed with BDB and then with washing denaturing buffer (WDB) containing 8 M urea, 100 mM NaH2PO4, 10 mM Tris-HCl, pH 6.0. The elution of CbbR was carried out under native conditions at 4°C after equilibrating the column with native buffer (20 mM imidazole, 300 mM NaCl, 50 mM NaH2PO4, pH 8.0). His6-CbbR was eluted at a flow rate of 1 ml/min with eluting native buffer (250 mM imidazole, 300 mM NaCl, 50 mM NaH2PO4, pH 8.0). The eluted fractions were monitored at 280 nm. Fractions with the highest protein content were pooled, dialysed twice against 50 mM HEPES-NaOH, pH 7.8 containing 200 mM KCl, 10 m MgCl2, 1 mM dithiothreitol, 0.05 mM phenylmethylsulfonyl fluoride and 50% (w/v) glycerol. The final protein concentration was 4 mg/ml. Protein preparations were analyzed by SDS-polyacrylamide gel electrophoresis in 12% (w/v) polyacrylamide slab gels under reducing conditions in the presence of 100 mM β-mercaptoethanol. Gels were stained with Coomassie Brilliant Blue R-250. Protein contents were determined using the method of Bradford [24], with bovine serum albumin as a standard. CbbR was stored at -20°C.

Production of antisera to CbbR

Multiple intradermal injections were applied to immunize a female Californian giant rabbit (3.0 kg) as described by [25]. A fresh CbbR preparation (0.5 ml; 1 mg/ml) was emulsified in one volume of complete Freund adjuvant (Commonwealth Serum Laboratories, Melbourne, Australia). The emulsion was prepared under aseptic conditions and 1.0 ml was initially injected into four sites on the back of the animal. Booster injections were given in the same way 75 days after the primary immunization, except that incomplete Freund adjuvant was used. The immune response was monitored by Western Blotting assays with serum separated from test blood samples (1.0 to 2.0 ml) that were obtained from an ear vein every 15 to 20 days after each immunization.

Electrophoretic mobility shift assays (EMSA)

DNA fragments containing the four potential cbb operon promoter regions were amplified by PCR and simultaneously biotinylated using the biotin 5'-labelled primers (Table 2). DNA-binding assays were performed at 30°C in a final volume of 17 μl containing 12 mM HEPES-NaOH, pH 7.9, 4 mM Tris-HCl, pH 7.9, 1 mM EDTA, 60 mM KCl, 1 mM dithiothreitol, 10% (w/v) glycerol, 5 μg/μl of bovine serum albumin and 2 μg/μl of poly(dI-dC). The indicated amount of CbbR protein (~290 μM) was incubated with the biotin end-labeled target DNA (20 pmol) for 15 min. A 50-fold excess of unlabeled DNA probe was used to challenge the labeled probe. In supershift experiments, a 1:500 dilution of CbbR-specific antiserum was added to the reaction after DNA binding of CbbR and incubated for an additional 15 min. After the binding reactions, samples were loaded onto a low-ionic strength nondenaturing polyacrylamide gel (4.8% [w/v], which had been prerun at a constant current of 200 mA for more than 90 min, and electrophoresed at 150 mA for about 60 min in 0.5× TBE buffer (89 mM Tris base, 89 mM boric acid and 2 mM EDTA). The separated CbbR-DNA complexes were electrophoretically transferred from the gel onto a nylon membrane in semi-dry blotting apparatus (Biometra, Göttingen). CbbR-DNA binding was detected using a streptavidin-horseradish peroxidase conjugate and a chemiluminescent substrate (Pierce) followed by autoradiography.

Bioinformatic analyses

Metabolic pathways involved in CO2 assimilation were retrieved from KEGG http://www.genome.ad.jp/kegg/. Protein sequences derived from known genes involved in CO2 assimilation were used as query sequences to search the genome sequence of A. ferrooxidans ATCC 23270, using TBlastN and BlastP, respectively, with default parameters. When a prospective candidate gene was identified, its predicted protein sequence was then used to formulate a BlastP http://www.ncbi.nlm.nih.gov search of the nonredundant database at NCBI. Only bidirectional best hits were accepted as evidence for putative orthologs. Candidate genes and their translated proteins were further characterized employing the following bioinformatic tools: ClustalW [26] for primary structure similarity relations, PSI-PRED [27] for secondary structure predictions, Prosite [28] for motif predictions, ProDom [29] and Pfam [30] for domain predictions. Information regarding the organization of genes in A. ferrooxidans was obtained from [2]. Logos were generated using the web-based application available at http://weblogo.berkeley.edu/logo.cgi. The height of each letter in bits corresponds to its relative abundance at each position. Promoters of the σ70-type and rho-independent transcriptional stops were predicted for operons cbb1-4 using the programs BPROM http://www.softberry.com and Transterm [31], respectively.

The organization of gene clusters in facultative and obligate autotrophs involved in the CBB cycle was derived from information available in IMG-JGI http://www.jgi.doe.gov/ and MicrobesOnline http://www.microbesonline.org/, with additional information added for H. marinus[18] and A. ferrooxidans, Acidithiobacillus caldus and Acidithiobacillus thiooxidans (this study). The phylogenetic cladogram of these bacteria was constructed from 16 S rRNA sequences obtained from KEGG Orthology K01977 http://www.genome.jp/kegg/ko.html and from GenBank http://www.ncbi.nlm.nih.gov/ for A. caldus (GI454888), A. thiooxidans (GI454888) and H. marinus (GI3882094). 16 S rRNA alignments were carried out using ClustalW and the cladogram was constructed by the NJ method using the program MEGA 4.0 [32]. The robustness of the tree was evaluated by bootstrapping using 1000 replicas. The tree was rooted using the 16 S rRNA of the ε-proteobacterium Helicobacter pylori.

Results, Discussion and Conclusions

The genome of A. ferrooxidans ATCC 23270 encodes CbbR, a LysR-type transcription factor

A gene cbbR was predicted in the genome of A. ferrooxidans ATCC 23270 (type strain) that potentially encodes a protein with significant amino acid sequence similarity and domain structure to other well-documented CbbRs of the LysR family of transcription factors (Additional file 1). cbbR is divergently transcribed from cbbL1, a gene predicted to encode the large subunit of form I RubisCO. The genetic linkage between cbbR and cbbL1 is known to be conserved in a number of autotrophic bacteria that fix CO2 via the CBB cycle such as Acidithiobacillus ferrooxidans Fe1 [4], Hydrogenophilus thermoluteolus[33], Nitrosomonas europaea[19], Rhodobacter sphaeroides[34], Rhodobacter capsulatus[35], R. eutropha H16 [36], Rhodospirillum rubrum[17], Thiobacillus denitrificans[14] and Xanthobacter flavus[9]. We here extend this list to include: Alkalilimnicola ehrlichii, Halorhodospira halophila, Methylibium petroleiphilum, Nitrobacter winogradskyi, Nitrosococcus oceani, Nitrosospira multiformis, Thiomicrospira crunogena and Xanthobacter autotrophicus (Additional file 2).

The cbbR-cbbL1 intergenic region of A. ferrooxidans strain Fe1 has been shown to contain divergent σ70-type promoters and to exhibit two CbbR binding sites that partially overlap these promoters ([4], Figure 1A). The binding sites conform to the pseudo-palindromic motif TNA-N7-TNA [13] that is a subset of the consensus LysR-type transcription factor binding site T-N11-A [37]. Logos were derived from a multigenome comparison of the cbbR-cbbL1 intergenic region of a number of bacteria (Additional file 3) and were aligned with the CbbR sites of A. ferrooxidans strain Fe1, allowing the prediction of the CbbR binding sites of A. ferrooxidans ATCC 27230 (Figure 1B and 1C).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2180-10-229/MediaObjects/12866_2010_Article_1185_Fig1_HTML.jpg
Figure 1

The cbbR - cbbL1 intergenic regions of A. ferrooxidans strains Fe1 and ATCC 23270. (A) DNA sequence of cbbR-cbbL1 intergenic region of A. ferrooxidans Fe1 showing two TNA-N7-TNA CbbR-binding regions (boxed sequences) and experimentally verified nucleotides protected by CbbR binding (*) and σ70 promoter regions (-10 and -35 sites) (Modified from [5], with permission of the publisher). (B) Logos derived from multiple sequence alignments of the cbbR-cbbL1 intergenic region of eight bacteria showing conservation of the CbbR-binding sites (more information in additional file 3). (C) Prediction of CbbR-binding sites and σ70 promoter regions in the cbbR-cbbL1 intergenic region of A. ferrooxidans ATCC 23270 by comparison with experimentally verified regions of A. ferrooxidans Fe1 and using the information derived from Logos.

Organization and expression of gene clusters predicted to be involved in CO2 fixation and associated pathways of central carbon metabolism

A cluster of 16 genes, termed cbb1, was predicted to be involved CO2 fixation. RT-PCR experiments showed that cbb1 is transcribed as a single unit and thus can be considered to be an operon (Figure 2A). Operon cbb1 consists of cbbL1 and cbbS1, potentially encoding the large and small subunits of form IAc RubisCO, seven cso genes predicted to be involved in α-carboxysome formation, two genes (cbbQ1 and cbbO1) presumed to be involved in RubisCO activation and cbbA, potentially encoding a fructose-1,6-bisphosphate aldolase. Gene descriptions are provided in Table 3.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2180-10-229/MediaObjects/12866_2010_Article_1185_Fig2_HTML.jpg
Figure 2

Organization and co-transcription of four cbb gene clusters in A. ferrooxidans ATCC 23270. (A) cbb1 (B) cbb2 (C) cbb3 and (D) cbb4. The following are represented in each of the panels A-E: (a) nucleotide sequences of the predicted σ70-like promoter region (-10 and -35 sites in italics) and potential CbbR-binding sites in grey boxes with the LysR-type TNA-N7-TNA and T-N11-A consensus binding sites in bold letters, (b) gene organization of the respective operons with predicted rho-independent transcriptional stop sites indicated as stem-loop symbols, (c) locations of PCR primers used for RT-PCR experiments (indicated by numbers) or EMSA assays (indicated by letters) and (d) gel electrophoresis of fragments amplified by RT-PCR using purified cellular RNA as template. A 1-kb scale bar is shown. One of the T-N11-A consensus binding sites in the cbb4 operon is part of a larger pseudo-palindrome indicated by inverted arrows. Predicted gene functions are provided in Table 3.

Table 3

Predicted genes of cbb operons

*Accession

aGene

name

bPredicted function

cBest BlastP hit

d% Similarity

eScore

fE-value

gDomains and motifs

Operon cbb1

       

ACK78724.1

cbbR

LysR family transcriptional regulatory protein CbbR

Nitrococcus mobilis

76

363

7e-99

PD462572, PD756396, Pfam03466, Pfam00126, COG0583

ACK79627.1

cbbL1

Ribulose bisphosphate carboxylase large subunit 1 [4.1.1.39]

Halothiobacillus neapolitanus

94

882

0

PD417314, PD000044, Pfam00016, Pfam02788, COG1850

ACK77836.1

cbbS1

Ribulose bisphosphate carboxylase small subunit 1 [4.1.1.39]

Methylococcus capsulatus

80

161

8e-39

PD000290, Pfam00101, COG4451

ACK78689.1

csoS2

Carboxysome structural peptide

Thiobacillus denitrificans

59

325

9e-87

PD579361, tat signal peptide

ACK80925.1

csoS3

Carboxysome structural peptide

Thiobacillus denitrificans

65

537

5e-151

PD191834, Pfam08936

ACK80352.1

csoS4A

Carboxysome peptide A

Thiobacillus denitrificans

93

139

6e-32

PD012510, Pfam03319, COG4576, tat signal peptide

ACK79436.1

csoS4B

Carboxysome peptide B

Thiobacillus denitrificans

82

119

7e-26

PD012510, Pfam03319, COG4576

ACK78722.1

csoS1C

Microcompartments protein

Nitrosomonas eutropha

97

142

6e-33

PD003442, Pfam00936, COG4577

ACK79154.1

csoS1A

Microcompartments protein

Nitrosomonas eutropha

97

144

1e-33

PD003442, Pfam00936, COG4577

ACK79584.1

csoS1B

Microcompartments protein

Nitrosomonas eutropha

95

146

3e-34

PD003442, Pfam00936, COG4577

ACK79096.1

bfrA

Bacterioferritin

Thiobacillus denitrificans

70

135

6e-31

PDA00179, Pfam00210, COG1633

ACK77923.1

hyp1

Hypothetical protein

Thiobacillus denitrificans

81

68

2e-10

PDA1E0I5

ACK80576.1

parA

Partition protein A

Thiobacillus denitrificans

72

196

6e-49

PD194671, Pfam01656, COG1192

ACK78664.1

hyp2

Hypothetical protein

Acidithiobacillus ferrooxidans

100

156

1e-09

 

ACK80060.1

cbbQ1

Rubisco activation protein

Nitrosomonas europaea

92

489

5e-137

PD490543, Pfam08406, Pfam07728, COG0714, COG5271

ACK80817.1

cbbO1

Rubisco activation protein

Thiobacillus denitrificans

74

940

0

PD140693, PD679436, Pfam00092, COG4867, COG4548

ACK80290.1

cbbA

Fructose-bisphosphate aldolase [4.1.2.13]

Bradyrhizobium sp.

61

295

3e-78

PD002376, PD030418, Pfam01116, Pfam07876, COG191

Operon cbb2

       

ACK80366.1

cbbL2

Ribulose bisphosphate carboxylase/oxygenase large subunit 2 [4.1.1.39]

Thiobacillus denitrificans

97

920

0

PD417314, PD000044, Pfam00016, Pfam02788, COG1850

ACK79774.1

cbbS2

Ribulose bisphosphate carboxylase/oxygenase small subunit 2 [4.1.1.39]

Thiobacillus denitrificans

88

203

3e-51

PD000290, Pfam00101, COG4451

ACK80953.1

cbbQ2

Rubisco activation protein

Nitrosomonas europaea

92

483

6e-135

PD490543, PD372819; Pfam08406, Pfam07728, COG0714

ACK78928.1

cbbO2

Rubisco activation protein

Thiobacillus denitrificans

76

965

0

PD140693, PD025507, COG4548

Operon cbb3

       

ACK80740.1

hyp3

Hypothetical protein

Thiobacillus denitrificans

49

149

8e-9

PD796582

ACK78212.1

suhB

Inositol-phosphate phosphatase [3.1.3.25]

Methylococcus capsulatus

66

646

8e-66

PD001491, PD013702, pfam00459, pfam00316, COG0483, COG1218

ACK80404.1

cbbF

Fructose-1,6-bisphosphatase [3.1.3.11]

Mariprofundus ferrooxydans

71

823

3e-86

PD007014, PD863173, pfam03320, COG1494

ACK79091.1

cbbT

Transketolase [2.2.1.1]

Methylococcus capsulatus

75

2264

0.0

PD308336, pfam00456, pfam02779, COG3959, COG0021

ACK78716.1

cbbG

Glyceraldehyde-3-phosphate dehydrogenase type I [1.2.1.-]

Burkholderia thailandensis

82

1189

1e-128

PD959395, PD859695, pfam02800, pfam00044, COG0057

ACK79414.1

cbbK

Phosphoglycerate kinase [2.7.2.3]

Alcanivorax borkumensis

80

1296

6e-141

PD000619, PDA014E1, pfam00162, COG0126

ACK78522.1

pykA

Pyruvate kinase II [2.7.1.40]

Thiobacillus denitrificans

79

1491

2e-163

PD983049, PD745602, pfam00224, pfam02887, COG0469

ACK79923.1

cbbA

Fructose-bisphosphate aldolase [4.1.2.13]

Nitrosococcus oceani

90

1474

1e-161

PD875785, PD002376, pfam01116, COG0191

ACK80630.1

cbbE

Ribulose-5-phosphate 3-epimerase [5.1.3.1]

Herminiimonas arsenicoxydans

80

753

2e-78

PD003683, PD591639, pfam00834, COG0036

ACK80633.1

cbbZ

Phosphoglycolate phosphatase [3.1.3.18]

Thiobacillus denitrificans

64

484

4e-47

PD946755, PDA11895, pfam00702, COG0546, COG0637

ACK78314.1

trpE

Anthranilate synthase component I [4.1.3.27]

Methylococcus capsulatus

77

1569

2e-172

PD005777, PD105823, pfam00425, pfam04715, COG0147, COG1169

ACK78895.1

trpG

Anthranilate synthase component II [4.1.3.27]

Nitrosomonas europaea

86

770

2e-80

PD806135, PD976090, pfam00117, pfam07722, COG0512, COG0518

Operon cbb4

       

ACK79981.1

metK

S-adenosylmethionine synthetase [2.5.1.6]

Ralstonia eutropha

86

591

2e-167

PD499406, PD606972, pfam02773, pfam02772, COG0192

ACK78713.1

sahA

S-adenosyl-L-homocysteine hydrolase [3.3.1.1]

Pseudomonas stutzeri

88

748

0

PD730548, PD551162, pfam05221, pfam00670, COG0499

ACK78001.1

metF

5,10-methylenetetrahydrofolate reductase [1.7.99.5]

Methylococcus capsulatus

69

306

1e-81

PD756524, PD763008, pfam02219, COG0685

ACK78673.1

cbbP

Phosphoribulokinase [2.7.1.19]

Nitrosococcus oceani

78

402

2e-110

PD739884, PD015803, pfam00485, COG3954

ACK79243.1

ynbD

Phosphosterase, PA-phosphatase

Polaromonas naphthalenivorans

81

759

1e-81

PD589889, pfam 01569, COG0474, CD03386, CD00127

* The sequence and annotation of the complete A. ferrooxidans strain ATCC 23270 genome is available at the Comprehensive Microbial Resource (CMR) (J. Craig Venter Institute, http://www.jcvi.org) and in GenBank/EMBL/DDBJ accession number CP001219.

a Proposed gene name.

b Proposed enzyme activity with EC number if available

c Organism with the best BlastP hit to the candidate gene.

d Percentage of similarity (% Sim) of candidate gene to that found in the organism listed in row (c).

e Score of BlastP match.

f E value of BlastP match.

g Motif and domains identified in the candidate proteins: CD, Conserved Domains; COG, Clusters of Orthologous Groups of Proteins; Pfam, protein families; PD, Prodom (protein domains); PS, Prosite tat signal peptide

Three additional gene clusters termed cbb2 (four genes), cbb3 (twelve genes) and cbb4 (five genes) were identified that are predicted to encode functions related to CO2 fixation and central carbon metabolism (Table 3). RT-PCR experiments revealed that gene clusters cbb2, cbb3 and cbb4 are transcribed as single units, respectively, and thus constitute operons (Figure 2B-D). cbb2 contains genes (cbbL 2 and cbbS2) encoding additional copies of the large and small subunit of form IAq RubisCO and associated RubisCO activation genes (cbbQ2 and cbbO2) (Figure 2B). The deduced amino acid sequences of these genes are similar but not identical to the corresponding proteins encoded in the cbb1 operon; CbbL1 and CbbL2 exhibit 84% amino acid sequence identity, whereas CbbS1 and CbbS2 share 56% identity and CbbQ1 and CbbO1 have 84% and 59% identity with CbbQ2 and CbbO2, respectively.

Genes predicted to be encoded by operons cbb3 and cbb4 are listed in Table 3 and their organization within these operons is shown in Figure 2.

The two enzymes that are unique to the CBB cycle are RubisCO (encoded by operons cbb1 and cbb2) and phosphoribulokinase (encoded by operon cbb4). RuBisCO catalyzes the first step of the cycle, the carboxylation of ribulose-1,5-bisphosphate (RuBP) with CO2. Phosphoribulokinase catalyzes the last step of the cycle which is the regeneration of the CO2 acceptor molecule, RuBP, by phosphorylation of ribulose 5-phosphate with ATP. Other steps of the cycle, encoded in operon cbb3, are catalyzed by enzymes common to glycolytic and gluconeogenic pathways in central carbon metabolism [8, 36].

Promoters of the σ70-type and rho-independent transcriptional stops were predicted for operons cbb1-4 (Figure 2). In addition, potential CbbR-binding sites were identified in the four operons based on the detection of conserved TNA-N7-TNA and T-N11-A motifs described above for operon cbb1 (Figure 2).

CbbR binds in vitro to the predicted σ70-like promoter regions of operons cbb1-4

Binding of CbbR to DNA fragments containing the predicted promoters of the four operons cbb1-4 was evaluated in vitro by electrophoretic mobility shift assays (EMSAs). For this purpose the cbbR gene was cloned and expressed in E. coli. Purified CbbR was used to prepare antisera (anti-CbbR antibodies) whose activity was checked by Western blotting against purified CbbR (data not shown). Biotin-labeled promoter DNA for the EMSA assays was prepared by PCR using primers specified in Table 2 and whose locations within the four operons are shown in Figure. 2.

Results show that CbbR was able to retard the promoter regions of the cbb1, cbb2 and cbb3 operons but not the cbb4 operon (Figure 3). When a 50-fold molar excess of unlabelled fragment was included in the binding assay retardation of the labelled fragments was abolished. Furthermore, the addition of anti-CbbR antibodies to the reaction produced a supershift in migration, indicating that the shift was caused specifically by the binding of CbbR.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2180-10-229/MediaObjects/12866_2010_Article_1185_Fig3_HTML.jpg
Figure 3

Binding of CbbR to the promoter regions of the operons cbb1-4 using the EMSA assay in the presence (+) or absence (-) of competing 50× excess of unlabelled probe DNA (P[50x]) or antibodies to CbbR (anti-CbbR). Abbreviations: P*, probe DNA; S, shift; SS, supershift.

Binding of CbbR to the predicted promoter regions of operons cbb1-3 suggests that it is involved in their regulation. The reason for the failure of CbbR to retard the DNA fragment containing the predicted promoter of the cbb4 operon is not known. Perhaps this fragment requires the presence of additional factors for CbbR binding that are not present in the in vitro cocktail used for the EMSA analysis. Alternatively, the predicted CbbR binding site is not functional.

Gene organization of the cbb operons

The cbb3 operon includes not only genes involved in carbon assimilation but also harbors genes with similarity to trpE and trpG that are predicted to encode the components I and II of anthranilate synthase, the first enzyme of the tryptophan biosynthesis pathway. Anthranilate synthase catalyzes the conversion of chorismate to anthranilate with the concomitant release of pyruvate [38, 39]. In some cases, this conversion can be accomplished by TrpE alone [40].

In order to determine if the association between trpEG and the cbb genes is restricted to A. ferrooxidans, an examination of gene organization was carried out in all sequenced genomes of facultative and obligate autotrophic proteobacteria. Twenty-six proteobacterial organisms (11 α-, 7 β- and 8 γ-) were analyzed, including 10 obligate autotrophs. Linkage between trpE/G and cbbE and/or cbbZ was found in all sequenced obligate autotrophs, all of which belong to the β- or γ-proteobacteria divisions (Figure 4, Table 4), whereas only 4 out of 14 facultative heterotrophs were detected with this clustering. These four exceptions are found only in the β- or γ-proteobacteria and none in the α-proteobacterial division (Figure 4, Table 4). This suggests a previously unreported linkage between genes encoding CBB cycle associated enzymes and trpEG or trpE that is most conserved in obligate autotrophs of the β- and γ-proteobacteria.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2180-10-229/MediaObjects/12866_2010_Article_1185_Fig4_HTML.jpg
Figure 4

Organization of gene clusters involved in the CBB cycle of facultative and obligate autotrophic α-, β- and γ-proteobacteria presented as a phylogenetic cladogram based on 16 S RNA. Numbers refer to bootstrapping results from 1000 trees. Organism names are provided in the text. The asterisk indicates that the respective organism is an obligate autotroph.

Table 4

Characteristics of cbb gene clusters in facultative and obligate, autotrophic bacteria.

Organism

Autotrophy status

Phyogenetic

classification

-proteo-bacteria

No. copies

cbbR

Presence

of cso genes?

trpE/G

associated with cbb?

cbb gene cluster associated with cbbP?

No. cbb

gene clusters

Acidithiobacillus ferrooxidans ATCC 23270 and ATCC 53993

obligate

Gamma-

2

Yes

Yes

No

5*

Acidithiobacillus thiooxidans ATCC 19377

obligate

Gamma-

2

Yes

Yes

No

5

Acidithiobacillus caldus ATCC 51756

obligate

Gamma-

2

Yes

Yes

No

5

Nitrosomonas europaea ATCC 19718

obligate

Beta-

1

No

Yes

No

4

Nitrosomonas eutropha C71

obligate

Beta-

1

Yes

Yes

No

4

Nitrosococcus oceani ATCC 19707

obligate

Beta-

1

No

Yes

No

4

Thiomicrospira crunogena XCL-2

obligate

Gamma-

3

Yes

Yes

No

5

5 Hydrogenovibrio marinus MH-110

obligate

Gamma-

2

Yes

N/D

N/D

3

Thiobacillus denitrificans ATCC 25259

obligate

Beta-

2

Yes

Yes

No

5

Nitrosospira multiformis ATCC 25196

obligate

Beta-

1

No

Yes

No

4

Methylococcus capsulatus Bath

obligate

methanotroph

Gamma-

1

No

Yes

Yes

3

1 Nitrobacter hamburgensis X14

facultative

Alpha-

3

Yes

No

Yes

3

Nitrobacter winogradskyi Nb-255

facultative

Alpha-

3

Yes

No

Yes

3

Halorhodospira halophila SL1

facultative

Gamma-

1

No

Yes3

Yes

2

Alkalilimnicola ehrlichii MLHE-1

facultative

Gamma-

1

No

Yes3

Yes

2

Bradyrhizobium sp. BTAi1

facultative

Alpha-

2

Yes

No

Yes

3

Bradyrhizobium japonicum USDA 110

facultative

Alpha-

1

No

No

Yes

1

Ralstonia eutropha H16

facultative

Beta-

1

No

No

Yes

24

Dechloromonas aromatica RCB

facultative

Alpha-

1

No

No

Yes

2

2 Magnetospirillum magneticum AMB-1

facultative

Alpha-

?

No

No

Yes

2

Paracoccus denitrificans PD1222

facultative

Alpha-

1

No

No

Yes

1

Rhodobacter sphaeroides 2.4.1

facultative

Alpha-

1

No

No

Yes

2

Rhodoferax ferrireducens T118

facultative

Beta-

1

No

No

Yes

1

Rhodopseudomonas palustris CGA009

facultative

Alpha-

2

No

No

Yes

3

Rhodospirillum rubrum ATCC 11170

facultative

Alpha-

1

No

No

Yes

1

Sinorhizobium meliloti 1021

facultative

Alpha-

1

No

No

Yes

1

*in addition to the four cbb operons described in this paper, a fifth gene cluster containing cbb genes (including a form II RubisCO gene) has recently been detected in A. ferrooxidans (43). 1Two copies of cbbR and two cbb gene clusters are present on two plasmids; 2two highly similar operons present in the genome; 3in these organisms, trpE gene is neighbor to cbbP but not cbbE. 4 R. eutropha H16 posesses a duplicated cbb operon, with similar copies in the chromosome and in a megaplasmid. 5 Data derived from cloned sequences (18). N/D = no data.

We hypothesize that in A. ferrooxidans production of pyruvate via anthranilate synthase activity provides a novel network connection between the CBB cycle on the one hand and general central carbon metabolism including the incomplete ("horseshoe"-like) TCA [2] on the other hand. Consistent with this idea is the presence of a predicted pykA upstream of trpEG in the cbb3 operon. PykA is predicted to encode pyruvate kinase that catalyzes the conversion of phosphoenol pyruvate (PEP) to pyruvate. In addition to supplying pyruvate, PykA could also reduce the level of intracellular PEP. PEP has been shown to be a ligand of CbbR in Ralstonia eutropha H16, promoting its binding to target DNA sites and consequently effecting the regulation of cbb genes [40]. If PEP carries out a similar function in A. ferrooxidans, the depletion of PEP via PykA activity could provide a means for feedback control of operons that are regulated by CbbR, including the auto-regulation of operon cbb3.

The organization of cbb genes in A. ferrooxidans exhibits similarities with obligate autotrophs that distinguish this group from facultative autotrophs. For example, A. ferrooxidans, contains three or more gene clusters dedicated to carbon assimilation. This is similar to other obligate autotrophic γ-proteobacteria including A. caldus, A. thiooxidans, Hydrogenovibrio marinus, Nitrosococcus oceani and Thiomicrospira crunogena, and obligate autotrophic β-proteobacteria such as Nitrosomonas europaea, Nitrosomonas eutropha, and Nitrosospira multiformis and Thiobacillus denitrificans. This contrasts with facultative autotrophs that contain only one or two cbb clusters (Figure 4, Table 4), with some exceptions, e.g. the α-proteobacteria Bradyrhizobium sp., N. hamburgensis, N. winogradski. R. sphaeroides and R. palustris and the β-proteobacterium R. eutropha, which contain unique, but duplicated, cbb clusters). Multiple cbb clusters could provide obligate autotrophs with a greater flexibility in regulating CO2 fixation compared to facultative autotrophs. For example, this flexibility may be necessary to adjust carbon assimilation in response to changing environmental concentrations of CO2[18], whereas facultative autotrophs might be able to circumvent this need by exploiting organic carbon sources in times of low CO2 concentrations.

Another characteristic of cbb gene organization in A. ferrooxidans is the lack of linkage of the phosphoribulokinsae gene, cbbP, with other cbb genes (Figure 4, Table 4) as has previously been reported for the deep-sea vent obligate chemolithoautotroph T. crunogena XCL-2 and for several other obligate autotrophs [20, 41]; we now extend this list to include A. ferrooxidans ATCC 23270 and ATCC 53993, A. caldus, A. thiooxidans H. marinus, N. europaea and Thiomicrospira crunogena (Figure 4, Table 4). In contrast, in all sequenced facultative autotrophs cbbP is associated with other cbb genes (Figure 4, Table 4).

In obligate autotrophs, the contextual disconnection of cbbP from cbbLS could provide greater flexibility for CO2 fixation by allowing RubisCO to be differentially expressed according to environmental and/or metabolic requirements without simultaneously expressing the remaining CBB cycle genes, many of which carry out functions in addition to carbon fixation. This is in sharp contrast to the organization found in most facultative autotrophs, where cbb P is usually juxtaposed to cbbLS and other genes of the CBB cycle facilitating their coordinate repression during heterotrophic growth [13, 20, 34, 36, 41].

Model for predicted enzymes and pathways involved in CO2 fixation

A model is proposed for Ci fixation in A. ferrooxidans based on the predicted roles of the genes encoded in the cbb operons (Figure 5). In contrast to most facultative autotrophs, the main focus of regulation of the CBB cycle in A. ferrooxidans may be the CO2 fixation reaction itself catalyzed by RubisCO, rather than at the level of the other CBB cycle enzymes. This hypothesis is supported by the observation that the genes encoding RubisCO and RubisCo accessory proteins, are clustered in operons that do not contain cbbP nor cbb that encode the main CBB enzymes. cbbP is also separated from the rest of the cbb genes in the cbb4 operon, with an apparent absence of CbbR binding to its promoter. We suggest that the promoters for the cbb1, cbb2 and cbb3 operons have different affinities for CbbR and may thus exhibit different regulation patterns, possibly associated with the environmental availability of CO2. The cbb1 operon, containing cbbLS-cso, is predicted to serve at low CO2 concentrations because carboxysomes have been shown to improve RubisCO catalytic efficiency by concentrating CO2[6, 13]. In contrast, the cbb2 operon, containing cbbLSQO, is predicted to be used when higher concentrations of CO2 are available since carboxysome synthesis is energetically and materially expensive [18].
https://static-content.springer.com/image/art%3A10.1186%2F1471-2180-10-229/MediaObjects/12866_2010_Article_1185_Fig5_HTML.jpg
Figure 5

Proposed roles of the (A) predicted enzymes and pathways involved in CO 2 fixation in A. ferrooxidans linked to (B) gene evidence. Genes are color-coded to match the predicted function of their products. RPI, ribose phosphate isomerase; G-3-P, glyceraldehyde-3-phosphate; DHAP, dihydroxyacetone phosphate; 3-PG, 3-phosphoglycerate; PEP, phosphoenolpyruvate.

The cbb3 operon, containing genes for most CBB cycle enzymes and pyruvate kinase, is proposed to be responsible for connecting CO2 fixation with the rest of central carbon metabolism. Except for cbbG and cbbK encoding glyceraldehyde-3-phosphate dehydrogenase, type I and phosphoglycerate kinase respectively, genes of the cbb3 operon have duplicated copies in the genome (data not shown), potentially allowing regulation of the CBB cycle independently of the remaining pathways of central carbon metabolism. For example, some CBB cycle intermediates also form part of gluconeogenesis and glycolysis resulting in the production of pyruvate that is channeled, via the pyruvate dehydrogenase complex, into the incomplete TCA "horseshoe" where the flux of intermediates serves for amino acid biosynthesis (e.g. glutamate). The pyruvate dehydrogenase also provides acetyl-CoA used in fatty acid biosynthesis. In addition, the presence of cbbZ in the cbb3 operon is associated with phosphoglycolate phosphatase activity, responsible for removal of phosphoglycolate, an undesirable product of the oxygenase activity of RubisCO, that must be detoxified preferentially by rechanneling to 3-phosphoglycerate [13, 36].

The co-transcriptional connection between the cbb, pykA and trpEG genes in the cbb3 operon may reflect the substrate requirement of anthranilate phosphoribosyltransferase for an activated pentose (5-phosphoribosyl 1-pyrophosphate) in order to proceed to the next step of tryptophan biosynthesis [42]. The production of the activated pentose would be stimulated by the activity of the operon. An alternate hypothesis is that the co-transcriptional connection represents a means for pyruvate regeneration since both pykA and trpE/G produce pyruvate.

In addition to the four cbb operons described herein, a fifth gene cluster has recently been detected in A. ferrooxidans that includes genes cbbM, cbbQ3 and cbbO3 predicted to encode form II of RubisCO and its associated chaperons, respectively [43]. The cluster also contains another putative cbbR divergently transcribed from cbbMQO. Future work will evaluate the role of this cluster in CO2 fixation.

Declarations

Acknowledgements

This work was supported by a grant from Fondecyt 1090451, a Microsoft Sponsored Research Award, a Deutscher Akademischer Austausch Dienst (DAAD) scholarship to ME, a CONICYT graduate student grant to J-PC and a grant from the Deutsche Forschungsgemeinschaft to BB.

Authors’ Affiliations

(1)
Center for Bioinformatics and Genome Biology, MIFAB, Fundación Ciencia para la Vida and Depto. de Ciencias Biologicas, Facultad de Ciencias Biologicas, Universidad Andres Bello
(2)
ICBM, Faculty of Medicine, University of Chile
(3)
Institut für Mikrobiologie und Genetik, Georg-August-Universität Göttingen
(4)
Departamento de Acuicultura, Facultad de Recursos del Mar, Universidad de Antofagasta

References

  1. Holmes D, Bonnefoy V: Genetic and bioinformatic insights into iron and sulfur oxidation mechanisms of bioleaching organisms. Biomining. Edited by: Rawlings DE, Johnson B. 2007, D: Springer Berlin Heidelberg, 281-307. full_text.View ArticleGoogle Scholar
  2. Valdes J, Pedroso I, Quatrini R, Dodson RJ, Tettelin H, Blake R, Eisen JA, Holmes DS: Acidithiobacillus ferrooxidans metabolism: from genome sequence to industrial applications. BMC Genomics. 2008, 9: 597-10.1186/1471-2164-9-597.PubMed CentralView ArticlePubMedGoogle Scholar
  3. Ask A Scientist. Carbon dioxide and water.http://www.newton.dep.anl.gov/askasci/chem03/chem03573.htm
  4. Kusano T, Sugawara K: Specific binding of Thiobacillus ferrooxidans RbcR to the intergenic sequence between the rbc operon and the rbcR gene. J Bacteriol. 1993, 175: 1019-1025.PubMed CentralPubMedGoogle Scholar
  5. Tabita FR: Molecular and cellular regulation of autotrophic carbon dioxide fixation in microorganisms. Microbiol Rev. 1988, 52: 155-189.PubMed CentralPubMedGoogle Scholar
  6. Price GD, Badger MR, Woodger FJ, Long BM: Advances in understanding the cyanobacterial CO2-concentrating-mechanism (CCM): functional components, Ci transporters, diversity, genetic regulation and prospects for engineering into plants. J Exp Bot. 2008, 59: 1441-1461. 10.1093/jxb/erm112.View ArticlePubMedGoogle Scholar
  7. Cannon GC, Baker SH, Soyer F, Johnson DR, Bradburne CE, Mehlman JL, Davies PS, Jiang QL, Heinhorst S, Shively JM: Organization of carboxysome genes in the thiobacilli. Curr Microbiol. 2003, 46: 115-119. 10.1007/s00284-002-3825-3.View ArticlePubMedGoogle Scholar
  8. Appia-Ayme C QR, Denis Y, Denizot F, Silver S, Roberto F, Veloso F, Valdes J, Cárdenas JP, Esparza M, Orellana O, Jedlicki E, Bonnefoy V, Holmes D: Microarray and bioinformatic analyses suggest models for carbon metabolism in the autotroph Acidithiobacillus ferrooxidans. Hydrometallurgy. 2006, 83: 273-280. 10.1016/j.hydromet.2006.03.029.View ArticleGoogle Scholar
  9. van den Bergh ER, Dijkhuizen L, Meijer WG: CbbR, a LysR-type transcriptional activator, is required for expression of the autotrophic CO2 fixation enzymes of Xanthobacter flavus. J Bacteriol. 1993, 175: 6097-6104.PubMed CentralPubMedGoogle Scholar
  10. Windhovel U, Bowien B: Identification of cfxR, an activator gene of autotrophic CO2 fixation in Alcaligenes eutrophus. Mol Microbiol. 1991, 5: 2695-2705. 10.1111/j.1365-2958.1991.tb01978.x.View ArticlePubMedGoogle Scholar
  11. Viale AM, Kobayashi H, Akazawa T, Henikoff S: rbcR [correction of rcbR], a gene coding for a member of the LysR family of transcriptional regulators, is located upstream of the expressed set of ribulose 1,5-bisphosphate carboxylase/oxygenase genes in the photosynthetic bacterium Chromatium vinosum. J Bacteriol. 1991, 173: 5224-5229.PubMed CentralPubMedGoogle Scholar
  12. Strecker M, Sickinger E, English RS, Shively JM: Calvin cycle genes in Nitrobacter vulgaris T3. FEMS Microbiology Letters. 1994, 120: 45-50. 10.1111/j.1574-6968.1994.tb07005.x.View ArticleGoogle Scholar
  13. Shively JM, van Keulen G, Meijer WG: Something from almost nothing: carbon dioxide fixation in chemoautotrophs. Annu Rev Microbiol. 1998, 52: 191-230. 10.1146/annurev.micro.52.1.191.View ArticlePubMedGoogle Scholar
  14. Beller HR, Chain PS, Letain TE, Chakicherla A, Larimer FW, Richardson PM, Coleman MA, Wood AP, Kelly DP: The genome sequence of the obligately chemolithoautotrophic, facultatively anaerobic bacterium Thiobacillus denitrificans. J Bacteriol. 2006, 188: 1473-1488. 10.1128/JB.188.4.1473-1488.2006.PubMed CentralView ArticlePubMedGoogle Scholar
  15. Gibson JL, Tabita FR: Nucleotide sequence and functional analysis of cbbR, a positive regulator of the Calvin cycle operons of Rhodobacter sphaeroides. J Bacteriol. 1993, 175: 5778-5784.PubMed CentralPubMedGoogle Scholar
  16. Paoli GC, Soyer F, Shively J, Tabita FR: Rhodobacter capsulatus genes encoding form I ribulose-1,5-bisphosphate carboxylase/oxygenase (cbbLS) and neighbouring genes were acquired by a horizontal gene transfer. Microbiology. 1998, 144 (Pt 1): 219-227. 10.1099/00221287-144-1-219.View ArticlePubMedGoogle Scholar
  17. Falcone DL, Tabita FR: Complementation analysis and regulation of CO2 fixation gene expression in a ribulose 1,5-bisphosphate carboxylase-oxygenase deletion strain of Rhodospirillum rubrum. J Bacteriol. 1993, 175: 5066-5077.PubMed CentralPubMedGoogle Scholar
  18. Toyoda K, Yoshizawa Y, Arai H, Ishii M, Igarashi Y: The role of two CbbRs in the transcriptional regulation of three ribulose-1,5-bisphosphate carboxylase/oxygenase genes in Hydrogenovibrio marinus strain MH-110. Microbiology. 2005, 151: 3615-3625. 10.1099/mic.0.28056-0.View ArticlePubMedGoogle Scholar
  19. Wei X, Sayavedra-Soto LA, Arp DJ: The transcription of the cbb operon in Nitrosomonas europaea. Microbiology. 2004, 150: 1869-1879. 10.1099/mic.0.26785-0.View ArticlePubMedGoogle Scholar
  20. Scott KM, Sievert SM, Abril FN, Ball LA, Barrett CJ, Blake RA, Boller AJ, Chain PS, Clark JA, Davis CR, Detter C, Do KF, Dobrinski KP, Faza BI, Fitzpatrick KA, Freyermuth SK, Harmer TL, Hauser LJ, Hügler M, Kerfeld CA, Klotz MG, Kong WW, Land M, Lapidus A, Larimer FW, Longo DL, Lucas S, Malfatti SA, Massey SE, Martin DD, McCuddin Z, Meyer F, Moore JL, Ocampo LH, Paul JH, Paulsen IT, Reep DK, Ren Q, Ross RL, Sato PY, Thomas P, Tinkham LE, Zeruth GT: The genome of deep-sea vent chemolithoautotroph Thiomicrospira crunogena XCL-2. PLoS Biol. 2006, 4: 383-10.1371/journal.pbio.0040383.View ArticleGoogle Scholar
  21. Quatrini R, Lefimil C, Veloso FA, Pedroso I, Holmes DS, Jedlicki E: Bioinformatic prediction and experimental verification of Fur-regulated genes in the extreme acidophile Acidithiobacillus ferrooxidans. Nucleic Acids Res. 2007, 35: 2153-2166. 10.1093/nar/gkm068.PubMed CentralView ArticlePubMedGoogle Scholar
  22. Maniatis T: Molecular cloning: a laboratory manual/T. Maniatis, E.F. Fritsch, J. Sambrook. 1982, Cold Spring Harbor, N.Y.: Cold Spring Harbor LaboratoryGoogle Scholar
  23. Guacucano M, Levican G, S Holmes D, Jedlicki E: An RT-PCR artifact in the characterization of bacterial operons. Electronic Journal of Biotechnology. 2000, 3: 12-13.Google Scholar
  24. Bradford MM: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976, 72: 248-254. 10.1016/0003-2697(76)90527-3.View ArticlePubMedGoogle Scholar
  25. Vaitukaitis J, Robbins JB, Nieschlag E, Ross GT: A method for producing specific antisera with small doses of immunogen. J Clin Endocrinol Metab. 1971, 33: 988-991. 10.1210/jcem-33-6-988.View ArticlePubMedGoogle Scholar
  26. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG: Clustal W and Clustal X version 2.0. Bioinformatics. 2007, 23: 2947-2948. 10.1093/bioinformatics/btm404.View ArticlePubMedGoogle Scholar
  27. Bryson K, McGuffin LJ, Marsden RL, Ward JJ, Sodhi JS, Jones DT: Protein structure prediction servers at University College London. Nucleic Acids Res. 2005, 33: W36-38. 10.1093/nar/gki410.PubMed CentralView ArticlePubMedGoogle Scholar
  28. Hulo N, Bairoch A, Bulliard V, Cerutti L, De Castro E, Langendijk-Genevaux PS, Pagni M, Sigrist CJ: The PROSITE database. Nucleic Acids Res. 2006, 34: D227-230. 10.1093/nar/gkj063.PubMed CentralView ArticlePubMedGoogle Scholar
  29. Bru C, Courcelle E, Carrere S, Beausse Y, Dalmar S, Kahn D: The ProDom database of protein domain families: more emphasis on 3D. Nucleic Acids Res. 2005, 33: D212-215. 10.1093/nar/gki034.PubMed CentralView ArticlePubMedGoogle Scholar
  30. Finn RD, Tate J, Mistry J, Coggill PC, Sammut SJ, Hotz HR, Ceric G, Forslund K, Eddy SR, Sonnhammer EL, Bateman A: The Pfam protein families database. Nucleic Acids Res. 2008, 36: D281-288. 10.1093/nar/gkm960.PubMed CentralView ArticlePubMedGoogle Scholar
  31. Jacobs GH, Chen A, Stevens SG, Stockwell PA, Black MA, Tate WP, Brown CM: Transterm: a database to aid the analysis of regulatory sequences in mRNAs. Nucleic Acids Res. 2009, 37: D72-76. 10.1093/nar/gkn763.PubMed CentralView ArticlePubMedGoogle Scholar
  32. Kumar S, Nei M, Dudley J, Tamura K: MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief Bioinform. 2008, 9: 299-306. 10.1093/bib/bbn017.PubMed CentralView ArticlePubMedGoogle Scholar
  33. Terazono K, Hayashi NR, Igarashi Y: CbbR, a LysR-type transcriptional regulator from Hydrogenophilus thermoluteolus, binds two cbb promoter regions. FEMS Microbiol Lett. 2001, 198: 151-157. 10.1111/j.1574-6968.2001.tb10635.x.View ArticlePubMedGoogle Scholar
  34. Dubbs JM, Bird TH, Bauer CE, Tabita FR: Interaction of CbbR and RegA* transcription regulators with the Rhodobacter sphaeroides cbbIPromoter-operator region. J Biol Chem. 2000, 275: 19224-19230. 10.1074/jbc.M002125200.View ArticlePubMedGoogle Scholar
  35. Dubbs P, Dubbs JM, Tabita FR: Effector-mediated interaction of CbbRI and CbbRII regulators with target sequences in Rhodobacter capsulatus. J Bacteriol. 2004, 186: 8026-8035. 10.1128/JB.186.23.8026-8035.2004.PubMed CentralView ArticlePubMedGoogle Scholar
  36. Bowien B, Kusian B: Genetics and control of CO2 assimilation in the chemoautotroph Ralstonia eutropha. Arch Microbiol. 2002, 178: 85-93. 10.1007/s00203-002-0441-3.View ArticlePubMedGoogle Scholar
  37. Schell MA: Molecular biology of the LysR family of transcriptional regulators. Annu Rev Microbiol. 1993, 47: 597-626. 10.1146/annurev.mi.47.100193.003121.View ArticlePubMedGoogle Scholar
  38. Knochel T, Ivens A, Hester G, Gonzalez A, Bauerle R, Wilmanns M, Kirschner K, Jansonius JN: The crystal structure of anthranilate synthase from Sulfolobus solfataricus: functional implications. Proc Natl Acad Sci USA. 1999, 96: 9479-9484. 10.1073/pnas.96.17.9479.PubMed CentralView ArticlePubMedGoogle Scholar
  39. Lin X, Xu S, Yang Y, Wu J, Wang H, Shen H: Purification and characterization of anthranilate synthase component I (TrpE) from Mycobacterium tuberculosis H37Rv. Protein Expr Purif. 2009, 64: 8-15. 10.1016/j.pep.2008.09.020.View ArticlePubMedGoogle Scholar
  40. Grzeszik C, Jeffke T, Schaferjohann J, Kusian B, Bowien B: Phosphoenolpyruvate is a signal metabolite in transcriptional control of the cbb CO2 fixation operons in Ralstonia eutropha. J Mol Microbiol Biotechnol. 2000, 2: 311-320.PubMedGoogle Scholar
  41. Kusian B, Bowien B: Organization and regulation of cbb CO2 assimilation genes in autotrophic bacteria. FEMS Microbiol Rev. 1997, 21: 135-155. 10.1111/j.1574-6976.1997.tb00348.x.View ArticlePubMedGoogle Scholar
  42. Ivens A, Mayans O, Szadkowski H, Wilmanns M, Kirschner K: Purification, characterization and crystallization of thermostable anthranilate phosphoribosyltransferase from Sulfolobus solfataricus. Eur J Biochem. 2001, 268: 2246-2252. 10.1046/j.1432-1327.2001.02102.x.View ArticlePubMedGoogle Scholar
  43. Esparza M, Bowien B, Holmes DS, Jedlicki E: Gene organization and CO2-responsive expression of four cbb operons in the biomining bacterium Acidithiobacillus ferrooxidans. Advanced Materials Research. 2009, 71-73: 207-210. 10.4028/www.scientific.net/AMR.71-73.207.View ArticleGoogle Scholar

Copyright

© Esparza et al; licensee BioMed Central Ltd. 2010

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.