The HP0256 gene product is involved in motility and cell envelope architecture of Helicobacter pylori

  • François P Douillard1Email author,

    Affiliated with

    • Kieran A Ryan1Email author,

      Affiliated with

      • Michael C Lane2,

        Affiliated with

        • Delphine L Caly1,

          Affiliated with

          • Stanley A Moore2,

            Affiliated with

            • Charles W Penn3,

              Affiliated with

              • Jason Hinds4 and

                Affiliated with

                • Paul W O'Toole1Email author

                  Affiliated with

                  BMC Microbiology201010:106

                  DOI: 10.1186/1471-2180-10-106

                  Received: 30 November 2009

                  Accepted: 8 April 2010

                  Published: 8 April 2010

                  Abstract

                  Background

                  Helicobacter pylori is the causative agent for gastritis, and peptic and duodenal ulcers. The bacterium displays 5-6 polar sheathed flagella that are essential for colonisation and persistence in the gastric mucosa. The biochemistry and genetics of flagellar biogenesis in H. pylori has not been fully elucidated. Bioinformatics analysis suggested that the gene HP0256, annotated as hypothetical, was a FliJ homologue. In Salmonella, FliJ is a chaperone escort protein for FlgN and FliT, two proteins that themselves display chaperone activity for components of the hook, the rod and the filament.

                  Results

                  Ablation of the HP0256 gene in H. pylori significantly reduced motility. However, flagellin and hook protein synthesis was not affected in the HP0256 mutant. Transmission electron transmission microscopy revealed that the HP0256 mutant cells displayed a normal flagellum configuration, suggesting that HP0256 was not essential for assembly and polar localisation of the flagella in the cell. Interestingly, whole genome microarrays of an HP0256 mutant revealed transcriptional changes in a number of genes associated with the flagellar regulon and the cell envelope, such as outer membrane proteins and adhesins. Consistent with the array data, lack of the HP0256 gene significantly reduced adhesion and the inflammatory response in host cells.

                  Conclusions

                  We conclude that HP0256 is not a functional counterpart of FliJ in H. pylori. However, it is required for full motility and it is involved, possibly indirectly, in expression of outer membrane proteins and adhesins involved in pathogenesis and adhesion.

                  Background

                  Helicobacter pylori is a Gram-negative bacterium, colonising the human gastric mucosa. It is responsible for diverse duodenal- and stomach-related disorders, such as ulcers, B cell MALT lymphoma and gastric adenocarcinoma [14]. Motility of this bacterium is accomplished by polar sheathed flagella and has been shown to be essential for colonisation, based on animal infection studies [5, 6]. Flagella are also involved in adhesion and induction of inflammatory response in the host [7]. Since motility is a virulence-related trait, improving our understanding of flagellum biogenesis in H. pylori might help develop intervention strategies or therapeutics.

                  H. pylori flagellar gene transcription is tightly controlled by three RNA polymerase sigma factors σ80, σ54 and σ28 [8, 9]. σ80 controls the transcription of class I genes (early flagellar genes). σ54 (RpoN) is responsible for the transcription of class II genes (middle flagellar genes). RpoN transcriptional activity is dependent on additional regulators, such the FlgR/FlgS system and the chaperone HP0958 [1012]. Class III genes (late flagellar genes) are under the control of σ28 (FliA) and the anti-sigma factor FlgM [13, 14].

                  The flagellar export system is recognized as a version of type III secretion systems [15], and during flagellar assembly, it delivers structural components from the cytoplasm to the cell surface and growing organelle. This mechanism is dependent upon export chaperones that protect and deliver structural subunits to the membrane-associated export ATPase, FliI. In Salmonella, several flagellar chaperones have been identified. FlgN has chaperone activity for the hook proteins FlgL and FlgK. The chaperone FliT is dedicated to the capping protein FliD, and FliS to the flagellin FliC [1618]. The ablation of genes encoding FlgN, FliT and FliS impairs the stability and the secretion of their dedicated substrates FlgK, FlgL, FliC and FliD [16, 19]. Flagellar biogenesis has been extensively investigated in Salmonella and E. coli [15, 20, 21]. Annotation of two H. pylori genomes identified homologues of most flagellar genes of the Salmonella/E. coli paradigm [2225]. However, some flagellar homologues have not been found in H. pylori, presumably due to low sequence identity. Previous bioinformatics searches, targeting only functional domains, were successfully performed to identify the anti-sigma factor FlgM [13, 14], and FliK was also identified by a bioinformatic approach [26].

                  In an effort to identify novel flagellar genes in sequenced H. pylori genomes, bioinformatic analysis focusing on identification of specific and conserved domains of flagellar genes was performed. In Salmonella, FliJ is a 17 kDa protein with a relative abundance of charged residues. Fraser and colleagues showed that FliJ in Salmonella interacts with FliH (the presumptive inhibitor of the FliI ATPase) and FlhA (a flagellar biosynthesis protein) [27]. FliJ was initially thought to display chaperone activity [28]. However, a recent study clearly indicated that FliJ is not a export chaperone for subunits of the hook and the filament [29]. FliJ binds to export chaperones FlgN and FliT and is involved in an escort mechanism, whereby FliJ promotes cycling of the export chaperones FlgN and FliT. A FliJ homologue was not found in the initial annotation of two H. pylori genomes, nor incidentally were homologues for FlgN or FliT [22, 23, 25]. Although searches based on the full-length sequence of FliJ did not identify any H. pylori homologues, a search using only the essential FliJ domain (N-terminal coiled-coil domain) did reveal a potential homologue (P. W. O'Toole, unpublished). This analysis identified HP0256, encoding a hypothetical protein with unknown function and a predicted coiled coil domain.

                  In the present study, we phenotypically characterized a mutant lacking the HP0256 gene product and investigated the function of HP0256 in the flagellar regulon using global transcript analysis. The data suggest a novel role for HP0256 in motility but not flagellum assembly, and involvement in production of cell surface proteins.

                  Results

                  Bioinformatic analysis of HP0256

                  PSI-BLAST searches using the full length FliJ sequence from Salmonella did not identify any homologues in H. pylori. However, using only the FliJ N-terminal coiled-coil domain as a search query, HP0256 was identified as a potential FliJ homologue. The annotation of this H. pylori ORF indicates a hypothetical protein with an unknown function. Both FliJ and HP0256 proteins have a similar size (Salmonella FliJ, 147 amino-acids; HP0256, 142 amino-acids) and have a high likelihood of forming N-terminal coiled-coils. They share 17% identity and 44% similarity. In contrast, FliJ from Salmonella and E. coli are 88% identical and 96% similar. Further searches identified potential HP0256 homologues in more related species (Figure 1). An alignment of these is shown in Figure 2. HP0256 is 22% identical and 51% similar to WS2055 of Wolinella succinogenes, 28% identical and 51% similar to ZP_01374471 of Campylobacter concisus and 23% identical and 65% similar to CJ1497c of Campylobacter jejuni.
                  http://static-content.springer.com/image/art%3A10.1186%2F1471-2180-10-106/MediaObjects/12866_2009_Article_1062_Fig1_HTML.jpg
                  Figure 1

                  Gene synteny of HP0256 is conserved inHelicobactergenus (Panel A). Most HP0256 homologs were found in epsilonproteobacteria (Panel B). Schematics were generated using STRING from EMBL (string.embl.de/).

                  For each of the FliJ and HP0256 sequence groups, both Paircoil2 and PCOILS were run (for PCOILS, the multiple sequence alignment used to generate Figure 2 was used) [30]. For Paircoil2, approximately 10 FliJ annotated sequences, ranging from 35 to 15% overall identity, were used. Each sequence gave essentially the same profile, and the program output yielded the same region (plus or minus 5 residues on average) with the same heptad register. Hence the predicted coiled coil domains were internally consistent for the FliJ family and the HP0256 family. In addition, the predicted coiled coil domains matched between families [31].
                  http://static-content.springer.com/image/art%3A10.1186%2F1471-2180-10-106/MediaObjects/12866_2009_Article_1062_Fig2_HTML.jpg
                  Figure 2

                  Multiple sequence alignments of theH. pyloriHP0256 sequences and orthologues. The alignment was created using the GENEDOC programme. Residues in colour are conserved in sequences. Sequence regions labelled abcdefg have a high likelihood of forming coiled-coil domains. ALME, gene encoding the flagellar export protein FliJ of Alkaliphilus metalliredigens; PECA, gene encoding a putative flagellar biosynthesis chaperone FliJ of Pelobacter carbinolicus; BASU, gene encoding a flagellar biosynthesis chaperone of Bacillus subtilis; CLDI, gene encoding a flagellar protein of Clostridium difficile; LAIN, gene encoding a flagellar biosynthesis chaperone of Lawsonia intracellularis; SATY, gene encoding a flagellar biosynthesis chaperone of Salmonella enterica subsp. enterica serovar; PSAT, gene encoding the flagellar export protein FliJ of Pseudoalteromonas atlantica; LEPN, gene encoding the flagellar protein FliJ of Legionella pneumophila; XACA, gene encoding the protein FliJ of Xanthomonas axonopodis; Cacu_0256, gene encoding a PP-loop family protein of Campylobacter curvus; Cafe_0256, gene encoding an hypothetical protein of Campylobacter fetus; Caje_0256, gene encoding an hypothetical protein of Campylobacter jejuni; Cala_0256, gene encoding an hypothetical protein of Campylobacter lari; Hepy_0256, gene encoding an hypothetical protein of Campylobacter jejuni; Hehe_0256, gene encoding an hypothetical protein of Helicobacter hepaticus; Wosu_0256, gene encoding an hypothetical protein of Wolinella succinogenes; Thde_0256, gene encoding a conserved hypothetical protein of Thiomicrospira denitrificans.

                  The gene for the Salmonella FliJ protein is flanked by those of the FliI ATPase and the hook length control protein FliK, as part of the FliE operon. Flagellar genes in H. pylori are not contained in such large operons, but are scattered throughout the genome [23, 32]. HP0256 is flanked by an adenylosuccinate synthetase gene (purA/HP0255) as well as two outer membrane protein genes (omp7/HP0252 and omp8/HP0254), and three hypothetical genes, one of which encodes a predicted secreted protein (HP0257) and the other a predicted integral membrane protein (HP0258). When comparing HP0256 with homologues from related species, it did not appear that any one domain of the protein was more or less conserved (Figure 2). This agrees with previous studies of FliJ data suggesting that the entire protein is necessary for function [28]. As this bioinformatic analysis suggested HP0256 could be a FliJ homologue, we generated a HP0256 mutant by inserting a chloramphenicol resistance marker into the gene by allelic exchange as described in Methods. Growth rates and plate morphology of the HP0256 mutant were indistinguishable from the wild-type (data not shown).

                  Ablation of the HP0256 gene reduces motility

                  Motility plate assay indicated that the HP0256 mutant was significantly less motile than the wild-type (Figure 3). A similar phenotype was consistently observed in two H. pylori wild-type strains and their derivative HP0256 mutants (Figure 3), indicating that the reduced motility was not a strain-specific effect. However, the mutants retained some motility. In Salmonella, lack of FliJ abolishes motility [27], suggesting that HP0256 may not be a FliJ homologue as initially hypothesized. Complementation of a Salmonella FliJ mutant was attempted by introduction of the HP0256 gene expressed from an E. coli vector promoter. Motility plate assay indicated that motility was not restored in the Salmonella fliJ mutant, indicating that HP0256 was unlikely to be a functional FliJ homologue in Helicobacter pylori (data not shown). We complemented the P79-derivative HP0256 mutant, by expressing the HP0256 gene, integrated into the chromosome, under the control of the flaA promoter (Figure 3). Restoration of motility in the complemented mutant confirmed that the partial loss of motility in the mutant was due only to the lack of the HP0256 gene product.
                  http://static-content.springer.com/image/art%3A10.1186%2F1471-2180-10-106/MediaObjects/12866_2009_Article_1062_Fig3_HTML.jpg
                  Figure 3

                  The ablation of the HP0256 gene impairs motility inH. pylorithat may be restored by complementation, whenhp0256is put under the control of the promoter offlaA. Motility plate assay were performed four times. A. CCUG17874 wild-type strain; B. CCUG17874-hp0256KO; C. P79 wild-type strain; D. P79-hp0256KO; E. P79-hp0256KO complemented with pIR0601; F. P79-hp0256KO with empty vector (control).

                  An HP0256 mutant produces normal levels of flagellin and hook proteins

                  The partial loss of motility in the HP0256 mutant might have been due to altered production levels of major flagellar components. H. pylori flagellum filaments are made of two proteins, a major flagellin FlaA and a minor flagellin FlaB. The hook consists of FlgE protein. We investigated flagellin and hook protein production in an HP0256 mutant using immunoblotting analysis with anti-H. pylori flagellin antiserum [33]. The antiserum used for immunoblotting is reactive with both flagellins and the hook protein. Minamino et al. had previously described a Salmonella FliJ defective mutant which had less flagella than wild-type cells [28]. In contrast with a Salmonella FliJ mutant, we could not observe any significant difference in the amount of flagellin protein in the cytoplasm or envelope protein fractions of the HP0256 mutant compared to corresponding fractions from wild-type cells (Figure 4). The normal production of FlgE protein compared to the flgE up-regulation may be due to a post-transcriptional regulation. Interestingly, it appeared that there were more degradation products in the HP0256 mutant samples compared to the wild-type, and this was consistently observed in technical and biological replicates of the immunoblotting analyses we performed (not shown).
                  http://static-content.springer.com/image/art%3A10.1186%2F1471-2180-10-106/MediaObjects/12866_2009_Article_1062_Fig4_HTML.jpg
                  Figure 4

                  Mutation of HP0256 does not affect flagellin and hook protein production. Flagellin and hook protein levels in the HP0256-KO mutant and the wild-type were analyzed by SDS-PAGE and immunoblotting. Two independent immunoblottings were performed. Panel A, Coomassie blue staining protein gel, Panel B, immunobloting, Lane 1, Protein marker; lane 2, CCUG17874 cytoplasmic fraction; lane 3, CCUG17874 cell envelope fraction; lane 4, cytoplasmic fraction of CCUG17874 derivative HP0256-KO mutant and lane 5, cell envelope fraction of CCUG17874 derivative HP0256-KO mutant.

                  An HP0256 mutant displays a normal flagellum configuration

                  Another plausible explanation for the reduced motility in the HP0256 mutant would be the presence of flagella with an aberrant morphology. We therefore performed transmission electron microscopy to investigate the flagellum configuration in wild-type and mutant cells. Wild-type H. pylori CCUG17874 and P79 cells harboured 2-3 polar flagella (Figure 5). In the HP0256 mutant cells, the number and localization of flagella were similar to the wild-type cells (Figure 5). Flagella of the mutant cells had the same length as those on wild-type cells. They were sheathed and had normal flagellar hooks.
                  http://static-content.springer.com/image/art%3A10.1186%2F1471-2180-10-106/MediaObjects/12866_2009_Article_1062_Fig5_HTML.jpg
                  Figure 5

                  An HP0256 mutant has a normally assembled flagellum filament. The arrows indicate the localisation of the flagella in the cell. The transmission electron microscopy was performed on 50 cells for each strain. Panel A, CCUG17874 wild-type; panel B, P79 wild-type; panel C, CCUG17874-hp0256KO and panel D, P79-hp0256KO.

                  Transcriptional analysis of an HP0256 mutant

                  The flagellar circuitry in H. pylori consists of three sigma factors and other regulators, such as the anti-σ28 factor FlgM and the FlgR/FlgS activation system [8, 34]. The lack of one regulatory player can deregulate the whole flagellar biosynthetic cascade and alter motility in H. pylori. Since ablation of the HP0256 gene reduced motility, we investigated the effect of HP0256 mutation upon the expression of the flagellar regulon using global transcript analysis. Array analysis was performed in quadruplicate, including a dye-swap. Five genes were selected to confirm the reliability of our microarray data by qRT-PCR. Transcriptional level of hpn was unchanged in the HP0256 mutant and was therefore used a control for qRT-PCR. The fold changes thus established were in good agreement with the array data (Figure 6). The difference observed in fold-changes of flgE transcription between array data and qRT-PCR is due to the microarray analysis method used for the study. This method tends to attenuate the dispersion of the fold-changes compared to the overall signal on the slide.
                  http://static-content.springer.com/image/art%3A10.1186%2F1471-2180-10-106/MediaObjects/12866_2009_Article_1062_Fig6_HTML.jpg
                  Figure 6

                  Confirmation of transcriptional changes in selected flagellar genes in the HP0256 mutant using qRT-PCR. Fold changes and standard deviations were calculated using the era transcript abundance as reference. qRT-PCRs were performed on at least two biological replicates.

                  A total of forty six genes had altered expression levels in the HP0256 mutant. Nineteen genes were significantly up-regulated and twenty seven genes down-regulated in the HP0256 mutant compared to the wild-type strain (Table 1). Data for some biologically relevant genes, below the two-fold cut-off, are also included in Table 1. Among the differentially expressed genes, seventeen encode proteins associated with the membrane.
                  Table 1

                  Gene list of significantly up- and down-regulated genes in the HP0256 mutant based on the array experiment.

                  TIGR orf no.

                  Putative gene product (gene)

                  Expression ratio

                  p-value

                  Down-regulated genes:

                  Hp26695-0092

                  type II restriction enzyme M protein (hsdM)

                  0.15

                  0.02

                  HpJ99-1132

                  dimethyladenosine transferase

                  0.17

                  0.00

                  Hp26695-0093

                  alpha-2-fucosyltransferase

                  0.22

                  0.01

                  Hp26695-0229

                  outer membrane protein (omp6) ( hopA )

                  0.24

                  0.01

                  Hp26695-0492

                  flagellar sheath associated protein ( hpaA3 )

                  0.26

                  0.00

                  Hp26695-1210

                  serine acetyltransferase (cysE)

                  0.26

                  0.00

                  Hp26695-1587

                  conserved hypothetical protein

                  0.27

                  0.00

                  Hp26695-1208

                  ulcer associated adenine specific DNA methyltransferase

                  0.27

                  0.00

                  Hp26695-0610

                  toxin-like outer membrane protein

                  0.32

                  0.03

                  Hp26695-1207

                  hypothetical protein

                  0.34

                  0.01

                  HpJ99-0055

                  putative

                  0.35

                  0.03

                  Hp26695-1211

                  hypothetical protein

                  0.37

                  0.00

                  Hp26695-0430

                  hypothetical protein

                  0.40

                  0.04

                  Hp26695-1492

                  conserved hypothetical nifU-like protein

                  0.41

                  0.01

                  Hp26695-0805

                  lipooligosaccharide 5G8 epitope biosynthesis-associated protein

                  0.42

                  0.02

                  Hp26695-1203a

                  Preprotein translocase subunit SecE

                  0.43

                  0.01

                  Hp26695-1219

                  hypothetical protein

                  0.43

                  0.04

                  Hp26695-0711

                  hypothetical protein

                  0.45

                  0.01

                  Hp26695-1180

                  pyrimidine nucleoside transport protein (nupC)

                  0.46

                  0.03

                  Hp26695-0502

                  hypothetical protein

                  0.46

                  0.03

                  Hp26695-1589

                  conserved hypothetical protein

                  0.47

                  0.01

                  Hp26695-0094

                  alpha-2-fucosyltransferase

                  0.49

                  0.02

                  Hp26695-1334

                  hypothetical protein

                  0.49

                  0.01

                  Hp26695-0415

                  conserved hypothetical integral membrane protein

                  0.49

                  0.01

                  Hp26695-0340

                  hypothetical protein

                  0.49

                  0.00

                  Hp26695-0798

                  molybdenum cofactor biosynthesis protein C (moaC)

                  0.49

                  0.03

                  Hp26695-0892

                  conserved hypothetical protein

                  0.50

                  0.03

                  Hp26695-0331

                  cell division inhibitor ( minD )

                  0.59

                  0.04

                  Up-regulated genes:

                  Hp26695-0115

                  flagellin B ( flaB )

                  1.91

                  0.03

                  Hp26695-0979

                  cell divison protein ( ftsZ )

                  1.92

                  0.00

                  Hp26695-1469

                  outer membrane protein ( omp31 ) ( hopV )

                  1.96

                  0.00

                  Hp26695-1243

                  outer membrane protein ( omp28 ) ( babA )

                  1.96

                  0.00

                  Hp26695-0386

                  hypothetical protein

                  2.01

                  0.00

                  Hp26695-0831

                  conserved hypothetical ATP binding protein

                  2.04

                  0.01

                  Hp26695-0952

                  conserved hypothetical integral membrane protein

                  2.05

                  0.00

                  Hp26695-0311

                  hypothetical protein

                  2.16

                  0.00

                  Hp26695-0720

                  hypothetical protein

                  2.16

                  0.02

                  Hp26695-0943

                  D-amino acid dehydrogenase (dadA)

                  2.18

                  0.01

                  Hp26695-0896

                  outer membrane protein ( omp19 ) ( babB )

                  2.18

                  0.00

                  Hp26695-0590

                  ferredoxin oxidoreductase, beta subunit

                  2.23

                  0.01

                  Hp26695-0589

                  ferredoxin oxidoreductase, alpha subunit

                  2.27

                  0.01

                  Hp26695-1340

                  biopolymer transport protein ( exbD )

                  2.30

                  0.00

                  Hp26695-1339

                  biopolymer transport protein ( exbB )

                  2.36

                  0.00

                  Hp26695-0747

                  conserved hypothetical protein

                  2.44

                  0.03

                  Hp26695-0310

                  conserved hypothetical protein

                  2.48

                  0.00

                  Hp26695-1322

                  hypothetical protein

                  2.57

                  0.03

                  Hp26695-1076

                  hypothetical protein

                  2.59

                  0.00

                  Hp26695-1524

                  hypothetical protein

                  2.68

                  0.05

                  Hp26695-0721

                  hypothetical protein

                  2.99

                  0.00

                  Hp26695-0744

                  pseudogene

                  3.08

                  0.00

                  Hp26695-0719

                  hypothetical protein

                  3.34

                  0.01

                  Hp26695-0954

                  oxygen-insensitive NAD(P)H nitroreductase

                  3.53

                  0.00

                  The fold-change and the p-value are indicated. Bold fonts were used to highlight genes considered biologically relevant for the present study (surface-or motility-related genes). Full array datasets are in public databases as described in Methods.

                  Interestingly, four genes encoding proteins of the Hop outer membrane family were identified as differentially expressed in the HP0256 mutant by microarray analysis (hopA/HP0229, hopV/HP1469, babA/HP1423 and babB/HP0896). hopA was four fold down-regulated, whereas the other three Hop genes were up-regulated. HP1339 and HP1340, encoding respectively the biopolymer transport proteins ExbB and ExbD, were up-regulated in the HP0256 mutant. ExbB and ExbD in E. coli interact with the TonB-dependent energy transduction complex [35]. In E. coli, TonB is involved in the transduction of energy between the cytoplasmic membrane and the outer membrane [36]. Five genes involved in lipopolysaccharide (LPS) production were differentially expressed: HP0093 (alpha-(1,2)-fucosyltransferase), HP0094 (alpha-(1,2)-fucosyltransferase), HP0805 (lipooligosaccharide biosynthesis-associated protein) and HP0310 (contains a polysaccharide deacetylase Pfam domain).

                  We identified a number of flagellar genes with altered expression levels (Tables 1 and 2). Three RpoN-dependent genes were significantly up-regulated in the HP0256 mutant based on the microarray data and the qRT-PCR investigations, i.e. HP0115/flaB (encoding the minor flagellin FlaB), HP0870/flgE (encoding the hook protein FlgE) and HP1076 (encoding a hypothetical protein). Another RpoN-dependent gene HP1155/murG (transferase, peptidoglycan synthesis) was 1.955 fold up-regulated with a p-value of 0.034. However, RpoN and its associated regulators FlgR, HP0244 and HP0958 were transcribed at wild-type levels. As shown in Table 2, HP0492/hpaA3 (flagellar sheath associated protein) was significantly down-regulated. This gene is known to be essential for flagellar biogenesis, but its transcriptional regulation remains unclear. It has not yet been assigned to any flagellar gene class [8]. In the intermediate class, HP0367 (encoding a hypothetical protein) was 1.8 fold up-regulated with a p-value of 0.008. In class I genes, we did not observe significant changes. A slight down-regulation of genes encoding components of the secretion apparatus and the basal body, such as FliI, FliQ, FliB, FlgG, was noted without reaching the fold-change cut-off for significance. The fliN gene encoding a component of the switch was up-regulated (1.758 fold) with a p-value of 0.042.
                  Table 2

                  Differentially expressed flagellar genes in the HP0256 mutant.

                  Proposed Class

                  TIGR orf no.

                  Putative gene product (gene)

                  Expression ratio

                  p-value

                  Class I

                  HP0019

                  chemotaxis protein (cheV)

                  1.221

                  0.026

                   

                  HP0082

                  methyl-accepting chemotaxis transducer (tlpC)

                  0.945

                  0.378

                   

                  HP0099

                  methyl-accepting chemotaxis protein (tlpA)

                  1.401**

                  0.112

                   

                  HP0103

                  methyl-accepting chemotaxis protein (tlpB)

                  1.403**

                  0.05

                   

                  HP0173

                  flagellar biosynthetic protein (fliR)

                  1.000

                  0.997

                   

                  HP0244

                  signal-transducing protein, histidine kinase (atoS)

                  1.221

                  0.651

                   

                  HP0246

                  flagellar basal-body P-ring protein (flgI)

                  -

                  -

                   

                  HP0325

                  flagellar basal-body L-ring protein (flgH)

                  1.113

                  0.050

                   

                  HP0326

                  CMP-N-acetylneuraminic acid synthetase (neuA)

                  0.904

                  0.219

                   

                  HP0327

                  flagellar protein G (flaG)

                  0.749

                  0.238

                   

                  HP0351

                  basal body M-ring protein (fliF)

                  0.889

                  0.508

                   

                  HP0352

                  flagellar motor switch protein (fliG)

                  1.158

                  0.176

                   

                  HP0391

                  purine-binding chemotaxis protein (cheW)

                  1.668**

                  0.004

                   

                  HP0392

                  histidine kinase (cheA)

                  1.202

                  0.113

                   

                  HP0393

                  chemotaxis protein (cheV)

                  1.176

                  0.194

                   

                  HP0584

                  flagellar motor switch protein (fliN)

                  1.758**

                  0.042

                   

                  HP0599

                  hemolysin secretion protein precursor (hylB)

                  1.201

                  0.366

                   

                  HP0616

                  chemotaxis protein (cheV)

                  1.159**

                  0.162

                   

                  HP0684

                  flagellar biosynthesis protein (fliP)

                  0.510

                  0.058

                   

                  HP0685

                  flagellar biosynthetic protein (fliP)

                  0.493

                  0.066

                   

                  HP0703

                  response regulator

                  0.715

                  0.158

                   

                  HP0714

                  RNA polymerase sigma-54 factor (rpoN)

                  1.104

                  0.699

                   

                  HP0770

                  flagellar biosynthetic protein (flhB)

                  0.621

                  0.162

                   

                  HP0815

                  flagellar motor rotation protein (motA)

                  0.917

                  0.538

                   

                  HP0816

                  flagellar motor rotation protein (motB)

                  0.651

                  0.231

                   

                  HP0840

                  flaA1 protein

                  1.296

                  0.184

                   

                  HP1041

                  flagellar biosynthesis protein (flhA)

                  0.988

                  0.921

                   

                  HP1067

                  chemotaxis protein (cheY)

                  0.958

                  0.905

                   

                  HP1092

                  flagellar basal-body rod protein (flgG)

                  1.142

                  0.140

                   

                  HP1286

                  conserved hypothetical secreted protein (fliZ)

                  1.305

                  0.544

                   

                  HP1419

                  flagellar biosynthetic protein (fliQ)

                  0.636

                  0.036

                   

                  HP1420

                  flagellar export protein ATP synthase (fliI)

                  0.687

                  0.012

                   

                  HP1462

                  secreted protein involved in flagellar motility

                  1.306

                  0.003

                   

                  HP1575

                  homolog of FlhB protein (flhB2)

                  1.445

                  0.239

                   

                  HP1585

                  flagellar basal-body rod protein (flgG)

                  0.590

                  0.019

                  Class II

                  HP0114

                  hypothetical protein

                  1.230

                  0.357

                   

                  HP0115

                  flagellin B (flaB)

                  1.906

                  0.032

                   

                  HP0295

                  flagellin B homolog (fla)

                  1.734

                  0.179

                   

                  HP0869

                  hydrogenase expression/formation protein (hypA)

                  1.307

                  0.109

                   

                  HP0870

                  flagellar hook (flgE)

                  1.892*

                  0.067

                   

                  HP0906

                  hook length control regulator (fliK)

                  1.13**

                  0.230

                   

                  HP1076

                  hypothetical protein

                  2.595

                  0.001

                   

                  HP1119

                  flagellar hook-associated protein 1 (HAP1) (flgK)

                  1.300

                  0.224

                   

                  HP1120

                  hypothetical protein

                  1.199

                  0.390

                   

                  HP1154

                  hypothetical protein (operon with murG)

                  1.514

                  0.055

                   

                  HP1155

                  transferase, peptidoglycan synthesis (murG)

                  1.955

                  0.034

                   

                  HP1233

                  putative flagellar muramidase (flgJ)

                  1.400

                  0.144

                  Class III

                  HP0472

                  outer membrane protein (omp11)

                  1.649

                  0.009

                   

                  HP0601

                  flagellin A (flaA)

                  1.487

                  0.229

                   

                  HP1051

                  hypothetical protein

                  1.098

                  0.501

                   

                  HP1052

                  UDP-3-0-acyl N-acetylglucosamine deacetylase (envA)

                  1.648

                  0.054

                  Intermediate

                  HP0165

                  hypothetical protein

                  1.226

                  0.515

                   

                  HP0166

                  response regulator (ompR)

                  1.596

                  0.057

                   

                  HP0366

                  spore coat polysaccharide biosynthesis protein C

                  0.860

                  0.419

                   

                  HP0367

                  hypothetical protein

                  1.853

                  0.008

                   

                  HP0488

                  hypothetical protein

                  0.711**

                  0.031

                   

                  HP0907

                  hook assembly protein, flagella (flgD)

                  1.271

                  0.214

                   

                  HP0908

                  flagellar hook (flgE)

                  1.175

                  0.119

                   

                  HP1028

                  hypothetical protein

                  0.852

                  0.286

                   

                  HP1029

                  hypothetical protein

                  0.799

                  0.019

                   

                  HP1030

                  fliY protein (fliY)

                  0.860**

                  0.308

                   

                  HP1031

                  flagellar motor switch protein (fliM)

                  0.835

                  0.054

                   

                  HP1032

                  alternative transcription initiation factor, sigma28 (fliA)

                  0.923

                  0.371

                   

                  HP1033

                  hypothetical protein

                  0.896

                  0.467

                   

                  HP1034

                  ATP-binding protein (ylxH)

                  0.87**

                  0.352

                   

                  HP1035

                  flagellar biosynthesis protein (flhF)

                  0.921

                  0.187

                   

                  HP1122

                  anti-sigma 28 factor (flgM)

                  0.867

                  0.310

                   

                  HP1440

                  hypothetical protein

                  0.627

                  0.026

                   

                  HP1557

                  flagellar basal-body protein (fliE)

                  0.652

                  0.091

                   

                  HP1558

                  flagellar basal-body rod protein (flgC) (proximal rod protein)

                  0.899

                  0.480

                   

                  HP1559

                  flagellar basal-body rod protein (flgB) (proximal rod protein)

                  1.305

                  0.194

                   

                  HP0751

                  (flaG2)

                  1.203

                  0.350

                   

                  HP0752

                  flagellar cap protein (fliD)

                  1.003

                  0.986

                   

                  HP0753

                  flagellar chaperone (fliS)

                  0.981

                  0.825

                   

                  HP0754

                  flagellar chaperone (fliT)

                  1.09**

                  0.400

                  Not assigned

                  HP0410

                  flagellar sheath associated protein (hpaA2)

                  0.664

                  0.038

                   

                  HP0492

                  flagellar sheath associated protein (hpaA3)

                  0.256

                  0.000

                   

                  HP0797

                  flagellar sheath associated protein (hpaA)

                  0.801

                  0.170

                  Full array datasets are in public databases as described in Methods. Fold-changes and p-values were calculated based on 4 independent biological replicates as described in Methods. Open reading frames and gene annotations were based on the TIGR database [23]. The genes were classified in different flagellar classes, as previously proposed [8]. Confirmatory analysis by qRT-PCR was performed for genes with *. Values for genes with ** were lost during the initial array data analysis and subsequently recovered using 3 independent replicates. For technical reasons, some array spots could not be analyzed in individual arrays.

                  Two genes involved in the cell division process were affected in the HP0256 mutant. HP0331/minD, coding for a protein involved in the correct localisation of the cell division site [37], was 1.7 fold down-regulated in the HP0256 mutant compared to the wild-type (confirmed by qRT-PCR investigation). In E. coli, MinD (in synergy with MinC) inhibits the cell division protein FtsZ, that forms the FtsZ or Z ring at the septum [38, 39]. Interestingly, ftsZ was 1.9 fold up-regulated in the HP0256 mutant (Table 1).

                  Adhesion and pro-inflammatory properties of an HP0256 mutant

                  The microarray data indicated altered expression of a number of genes encoding proteins associated with the cell envelope in the HP0256 mutant. The genes encoding the well-characterized adhesins BabA and BabB which bind to fucosylated Lewis antigens on human gastric cells were up-regulated in the HP0256 mutant. To investigate a potential role of HP0256 in pathogenesis and adhesion, we measured adhesion of HP0256 mutant cells to gastric epithelial cells, and also interleukin-8 (IL-8) secretion by gastric epithelial cells using an in vitro infection model. Adhesion of the HP0256 mutant to AGS cells was significantly reduced to 45% of that of the wild-type (p < 0.05) (Figure 7). Supernatants from that assay were also used to quantify IL-8 production by AGS cells. CCUG17874 induced an average of 2434 pg/ml of IL-8 from AGS cells compared to 1944 pg/ml by the HP0256 mutant (Figure 7). This is a statistically significant decrease of 20% (p < 0.02).
                  http://static-content.springer.com/image/art%3A10.1186%2F1471-2180-10-106/MediaObjects/12866_2009_Article_1062_Fig7_HTML.jpg
                  Figure 7

                  The HP0256 mutant has lower adhesion ability compared to the wild-type and significantly induces a weaker IL-8 secretion in AGS cells. Panel A shows that the HP0256 mutant adheres significantly less to the AGS host cells compared to the wild-type. Panel B shows that the HP0256 mutant induces a lower IL-8 secretion of AGS cells compared to the wild-type cells. (*) indicates results with a p-value of less than 0.05.

                  Discussion

                  A focused bioinformatics analysis based on the functional domain of FliJ (N-terminal coiled-coil domain) suggested that HP0256 was a potential FliJ homologue in H. pylori. HP0256 encodes a hypothetical protein in H. pylori and shares common properties with FliJ, such as a similar size and a predicted N-terminal coiled coil. However, in comparison with the complete loss of motility reported in a Salmonella FliJ mutant [27], H. pylori HP0256 mutants retained some motility based on a motility plate assay. Complementation of a Salmonella FliJ mutant was attempted by introduction of the HP0256 gene product expressed under the control of an E. coli promoter, but this did not restore motility in the transformed Salmonella FliJ mutant (data not shown). Immunoblotting analysis revealed no significant differences in flagellin and hook protein synthesis between the wild-type and the HP0256 mutant. The partial loss of motility in the HP0256 mutant was therefore not due to impairment in filament and hook protein production. The increased degradation rate of flagellar proteins observed in the HP0256 mutant samples compared to the wild-type suggested a possible chaperone activity of HP0256. However, the apparently normal flagellum assembly and localisation at the pole in the HP0256 mutant cells suggested that HP0256 was not actually essential for flagellum protein stabilization or export apparatus positioning. In the HP0256 mutant, the significant reduction in motility still remained unclear. Quantitative data, e.g. average time and lengths of swimming runs, to characterize the motility phenotype of the HP0256 mutant would allow us to further comprehend the effect of HP0256 on Helicobacter pylori motility. Although this was not mechanistically wholly elucidated, the potential players in this phenotype were identified by array analysis.

                  Global transcript analysis indicated that HP0256 interferes with the transcription of flagellar genes belonging to the RpoN regulon. Four RpoN-dependent genes were up-regulated in the HP0256 mutant, although transcription of RpoN and its associated regulators FlgR, HP0244 and HP0958 were at wild-type level. The different transcriptional profiles among RpoN-dependent genes suggested that some key RpoN-dependent genes may be under additional regulatory checkpoints, likely HP0256-dependent. However, we do not have data to explain the mechanistic links involved in this regulation. Among class II genes, the only known flagellar regulator HP0906/FliK controls the hook length and is involved in the hook-filament transition. HP0906 was transcribed at wild-type level, in agreement with the normal flagellar morphology in HP0256 mutants (i.e. absence of polyhooks). The up-regulation of four RpoN-dependent genes in the HP0256 mutant did not grossly interfere with flagellar assembly as demonstrated by transmission electron microscopy (normal flagellum configuration in HP0256 mutants). However, a modification of the FlaA/FlaB ratio in flagella significantly affects motility [40] and this may still be responsible for the aberrant functioning of the flagellar organelle seen here.

                  Interestingly, HP0256 mutant cells were not predominantly swimming but tumbling, based on light microscopy observations. This abnormal motility behaviour, which may explain the reduced motility in the HP0256 mutant, underlined a probable disruption of the switch mechanism between swimming and tumbling. FliG, FliM and FliN are involved in switching between clockwise and counter-clockwise rotation of the motor and thus, of the filament [41, 42]. It is noteworthy that FliN was upregulated. Other components involved in the switch, FliM and FliG, were normally expressed. The FliM and FliN proteins assemble to form a ring, called the C-ring [41]. In Salmonella, the FliN protein is involved in the switch process and its interaction with FliH is crucial for the localisation of the FliI-FliH complex in the C-ring [43]. We hypothesize that the 1.758-fold overexpression of FliN may be sufficient to modify the stoichiometry of the switch subunits, disrupting the correct functioning of the switch. The HP0256 mutant cells would then be unable to properly respond to chemotactic environmental stimuli, as illustrated by the abnormal motility observed in the HP0256 mutant. A slight caveat for this hypothesis is that we do not have data to confirm an increase of FliN protein production in the HP0256 mutant.

                  A number of outer membrane proteins and LPS-related proteins were differentially expressed in the HP0256 mutant. BabA and BabB expression were both up-regulated in the HP0256 mutant. BabA binds to the blood group antigen Lewis b [44]. The sialic acid-specific adhesin HpaA is enriched in the flagellar sheath [45] and was significantly down-regulated in the HP0256 mutant. HpaA has been shown to be antigenic but not involved in the interaction with AGS cells [45]. The modifications of the cell envelope architecture, i.e. adhesins, hop proteins, alpha-2-fucosyltransferase, may explain the reduced ability of the HP0256 mutant to adhere to host cells and to induce an inflammatory response, i.e. interleukin-8 secretion. The disruption of HP0256 and its effect on cell envelope architecture may modify the lipid profiles and/or membrane fluidity and therefore the function of the methyl-accepting chemotactic proteins. The biological significance of the alteration of expression of minD and ftsZ in the HP0256 mutant, two genes involved in the cell division process, remains unclear. A correlation with other membrane-associated protein expression, such as outer membrane proteins, cannot be excluded and additional experiments will be required to test this.

                  Conclusions

                  We initially hypothesized that HP0256 was a FliJ homologue in H. pylori based on bioinformatic analyses. Our data clearly show that HP0256 has a different function in H. pylori, compared to that of FliJ in Salmonella. Interestingly, HP0256 is still obviously involved in flagellum activity as its ablation caused a partial loss of motility. Its involvement with expression of some RpoN-dependent genes is noteworthy but did not result in major changes in the mutant phenotype (normal flagellar apparatus configuration). The partial loss of motility must therefore be due to effects upon other flagellar players. Based upon its observed up-regulation in the HP0256 mutant, FliN is a potential candidate responsible for the impaired motility we observed in the HP0256 mutant. Further investigation of FliN production in the HP0256 mutant or overexpression in the wild-type would confirm this hypothesis. The large number of membrane-associated proteins with an altered expression in the HP0256 mutant highlighted another aspect of the mutant phenotype: the alteration of the cell envelope architecture, likely responsible for the weak adhesion to, and the low inflammatory response induced in, host cells. We conclude that HP0256 is required for full motility of H. pylori, possibly through its involvement with the switch components, but that it also modulates directly or indirectly the normal expression of membrane proteins essential in pathogenesis.

                  Methods

                  Bacterial strains, media and growth conditions

                  Bacterial strains used in this study are listed in Table 3. H. pylori strain P79 [46], a streptomycin mutant of the P1 wild-type strain, was generously provided by Dr. R. Haas. H. pylori strains were cultured as previously described [26]. Two H. pylori mutants lacking the HP0256 gene (one in CCUG17874 and one in P79) were generated as described below in Materials and Methods. Transformants were selected on CBA (Columbia agar base) plates supplemented with 10 μg/ml chloramphenicol (Sigma) and/or 50 μg/ml kanamycin (Sigma). One Shot TOP10 chemically competent E. coli cells (Invitrogen, CA, USA) were propagated on Luria-Bertani (LB) agar plates or LB broth at 37°C supplemented with antibiotics: 50 μg/ml kanamycin (Sigma), 100 μg/ml ampicillin (Merck, Germany) and 10 μg/ml chloramphenicol (Sigma).
                  Table 3

                  Strains and plasmids used in this study.

                  Strains or plasmids

                  Relevant characteristics

                  Reference or source

                  Strains

                    

                  H. pylori

                    

                  CCUG17874

                  wild-type strain

                  CCUG, Sweden

                  hp0256 KO

                  CCUG17874 Δhp0256::Cmr

                  This study

                  P1

                  wild-type strain

                  [57]

                  P79

                  P1 Strr

                  [58]

                  P79-hp0256KO

                  P79 Δhp0256::Cmr

                  This study

                  P79-0256/pIR203K04

                  P79 Δhp0256::Cmr with pIR203K04 (Kanr)

                  This study

                  P79-0256/pIR0601

                  P79 Δhp0256::Cmr with pIR0610 (Kanr)

                  This study

                  S. typhimurium

                    

                  SJW1103

                  wild-type strain

                  [59]

                  MKM40

                  SJW1103 ΔfliJ

                  [59]

                  MKM40-pQE60

                  SJW1103 ΔfliJ with empty pQE-60

                  This study

                  MKM40-pQE60-0256

                  SJW1103 ΔfliJ with pQE-60-0256

                  This study

                  E. coli

                    

                  One Shot TOP10

                  F- mcrA Δ(mrr-hsdRMS-mcrBC) ф80lacZ ΔM15 ΔlacX74 recA1 araΔ139 Δ(ara-leu)7697 galU galK rpsL (Strr) endA1 nupG

                  Invitrogen, USA

                  Plasmids

                    

                  pIR203K04

                  kanamycin resistance cassette (Kanr)

                  [51]

                  pIR0601

                  pIR203K04 with hp0256 gene under the control of hp0601 promoter

                  This study

                   

                  C-term His-tagged expression vector (Ampr)

                   

                  pQE-60

                  pQE-60 with hp0256 gene

                  Qiagen, Germany

                  pQE-60-0256

                  This study

                   

                  Cm, chloramphenicol, Kan, kanamycin; Str, streptomycin

                  Bioinformatics

                  PSI-BLAST was performed using bacterial sequences from the NCBI non-redundant protein databank at NCBI-BLAST. Three to four iterations were run and false-positives were edited from the output. Searching with Salmonella or other FliJ sequences did not result in significant hits with any HP0256 homologues. However, using one of the HP0256 homologues for a PSI-BLAST search often resulted in Bacillus FliJ sequences appearing just below the inclusion threshold with E-values ranging between 0.08 and 0.52. In addition, the alignments from these BLAST hits were deemed correct as judged by comparison to the multiple alignment presented in Figure 1. For each of the FliJ and HP0256 sequence groups, both Paircoil2 and PCOILS were run (for PCOILS, the multiple sequence alignment used to generate Figure 1 was used) [30].

                  Allelic exchange mutagenesis

                  Helicobacter DNA was isolated as previously described [47]. Oligonucleotides were purchased from Eurofins MWG Operon (Germany). Oligonucleotides ML022FP/ML027RP (Table 4) were designed for the amplification of a 216 bp fragment containing the 3' end of HP0255 and the 5' end of HP0256. Oligonucleotides ML028FP/ML023RP (Table 4) were designed for the amplification of a 245 bp fragment at the 5' end of HP0256. ML027RP and ML028FP had overlapping sequences and included a BglII restriction site. The two amplicons were joined together by extension overlap PCR and the resulting DNA product was cloned into pUC18 (New England Biolabs, USA) following BamHI and EcoRI digestion. The resultant plasmid was cut with BglII and ligated with the chloramphenicol acetyl transferase (cat) gene which had been cut from the plasmid pRY109 [48]. H. pylori cells were transformed with 1 μg of this plasmid for double-cross over gene disruption as previously described [26]. Polymerase chain reactions (PCR) were performed using 3 μM of each primer and 0.5 units per reaction of Vent Polymerase (New England Biolabs).
                  Table 4

                  Oligonucleotide sequences used in this study.

                  Primer

                  Sequence (5'-3')

                  Gene

                  Comments

                  flgE-F

                  GGCTAACGAGCGTGGATAAG

                  flgE

                  FP of flgE

                  flgE-R

                  GAGCGAGCGCTAAAGTCCTA

                  flgE

                  RP of flgE

                  era-F

                  AAGGCTAATGCGACCAGAAA

                  hp0517

                  FP of era

                  era-R

                  GGAGCCCTGGTGTGTCTAAA

                  hp0517

                  RP of era

                  ML022FP

                  CGGGATCCCGGGGCGAAAGATTGGAGATTT

                  hp0256

                  Allelic exchange mutagenesis

                  ML027RP

                  CCATCGTAGATCTGGGCTGC AGCGAATTTTTTCATAGAAAAATCG

                  hp0256

                  Allelic exchange mutagenesis

                  ML028FP

                  GCAGCCCAGATCTACGATGGGCAATTAAAAAGCGCTCTAAGAAT

                  hp0256

                  Allelic exchange mutagenesis

                  ML023RP

                  CGGAATTCCGTTACGCATGCAAGCCCTC

                  hp0256

                  Allelic exchange mutagenesis

                  HP0256-F2

                  TATAACAAGGAGTTACAACAATGAAAAAATTCGCTTCTGTG

                  hp0256

                  FP of hp0256

                  HP0256-R

                  GCGCGCATCGATTTACGCATGCAAGCCCTCTT

                  hp0256

                  RP of hp0256

                  FLA-F2

                  GCGCGCGGATCCCATGCTCCTTTAAATTTTGC

                  flaA

                  FP of flaA promoter

                  FLA-R

                  TGTTGTAACTCCTTGTTATA

                  flaA

                  RP of flaA promoter

                  minD-F

                  TAATTTAGCGATCGGCTTGG

                  minD

                  FP of minD

                  minF-R

                  TCCATCACATCCACCACATC

                  minD

                  RP of minD

                  hp0610-F

                  ATAACGGCGTTCATTCTTGG

                  hp0610

                  FP of hp0610

                  hp0610-R

                  GCGGTTGTTATGCAAGGTTT

                  hp0610

                  RP of hp0610

                  omp6-F

                  GCCCGATTCTAAAGGGTTTC

                  omp6

                  FP of omp6

                  omp6-R

                  GGCCAAACTCTTTGGTGGTA

                  omp6

                  RP of omp6

                  hpn-F

                  ATGGCACACCATGAAGAACA

                  hpn

                  FP of hpn

                  hpn-R

                  GATGAGAGCTGTGGTGGTGA

                  hpn

                  RP of hpn

                  HP0256-QF

                  GCGCGCCCATGG AAAAATTCGCTTCTGTATTGG

                  hp0256

                  FP of hp0256

                  HP0256-QR

                  GCGCGCGGATCC TTACGCATGCAAGCCCTCTTT

                  hp0256

                  RP of hp0256

                  FP, forward primer; RP, reverse primer.

                  Molecular cloning

                  Standard procedures were employed for plasmid cloning experiments in E. coli [49]. For complementation of a Salmonella fliJ mutant (strain MKM40, kind gift from the late Prof. R. M. Macnab), the HP0256 gene was amplified with primer pairs HP0256-QF/HP0256-QR (Table 4). The amplicons were digested with NcoI and BamHI, and ligated to similarly restricted pQE-60. Salmonella was transformed by electroporation using a standard protocol [50]. Electrocompetent Salmonella fliJ mutant cells were then transformed and transformants were selected on kanamycin (50 μg/ml). For complementation of the HP0256 mutant, a full length copy of the gene was introduced into the HP0203-HP0204 chromosomal intergenic region of a P79 HP0256-KO mutant according to the method described by Langford et al. using the pIR203K04 plasmid [51]. As expression of HP0256 is controlled by a promoter further upstream in a 5-gene operon, the gene was first amplified using the primers HP0256-F2 and HP0256-R and fused to the flaA promoter amplified using the primers FLA-F2 and FLA-R2, by overlap extension PCR. This composite fragment flaA promoter-HP0256 was then cloned into pIR203K04 as a Cla1/BamH1 fragment.

                  Transmission electron microscopy

                  Cell samples were subjected to negative staining. Whole cells of H. pylori were grown on a plate containing brain heart infusion (BHI) supplemented with 10% foetal calf serum, for 24 h in a micro-aerobic atmosphere. Next, cells were harvested and carefully resuspended in 2% ammonium molybdate (Sigma) with 70 μg/ml bacitracin (Sigma), as a wetting agent. 5 μl cell preparation was applied to a copper grid overlaid with a carbon-coated Formvar film. The excess sample was carefully removed and the copper grid was dried. The copper grids were observed in a JEOL JEM-1200EX transmission electron microscope at an accelerating voltage of 80 kV.

                  Plate motility assay

                  H. pylori strains and mutants were grown for 2 days on CBA plates and then stab inoculated on Brucella soft agar plates containing 0.3% (w/v) agar and 5% (v/v) heat-inactivated foetal bovine serum (Sigma). Motility plates were incubated at 37°C in an atmosphere containing 5% CO2 and periodically observed for halo formation.

                  Protein electrophoresis and blotting

                  A standard protocol was used to perform sodium dodecyl sulfate-polyacrylamide gel electrophoresis [52] and immunoblotting. Proteins from 12.5% acrylamide gels were transferred onto nitrocellulose membrane by electroblotting [53]. Polyclonal antibody directed against H. pylori flagellin and hook protein was used as primary antibody [33]. Anti-rabbit antibody conjugated to horseradish-peroxidase (Sigma) was used as secondary antibody. Hydrogen peroxide and 4-chloro-1-naphtol (Sigma) were employed for colour development.

                  Microarray analysis

                  To compare the transcriptional profiles of the wild-type and HP0256 mutant strains, a H. pylori whole genome microarray was used in a Common Reference or Type II experimental design whereby Cy5-labelled RNA from each strain was co-hybridised to an array with a Cy3-labelled genomic DNA reference. The microarray experiment was performed as described previously by Douillard et al. [54]. Four biological replicates, including a dye-swap, were performed for the global transcript comparison of the wild-type and the HP0256 mutant. The array design is available in BμG@Sbase (Accession No. A-BUGS-18; http://​bugs.​sgul.​ac.​uk/​A-BUGS-18) and also ArrayExpress (Accession No. A-BUGS-18). Fully annotated microarray data have been deposited in BμG@Sbase (accession number E-BUGS-98; http://​bugs.​sgul.​ac.​uk/​E-BUGS-98) and also ArrayExpress (accession number E-BUGS-98).

                  Quantitative analysis of transcription by Real-Time PCR

                  Quantitative real-time PCR (qRT-PCR) was performed as a confirmatory test on selected genes following global transcript analysis by microarray. Real-time PCR primers were designed using the Primer3 software package [55] and are listed in Table 4. qRT-PCRs were performed as previously described [54]. Reactions were performed in triplicate (technical replicates) from at least two independent RNA preparations (biological replicates).

                  Adhesion and interleukin-8 ELISA

                  AGS gastric epithelial cells were grown in six-well plates at 3.2 × 105 cells per well for six days. H. pylori cells were harvested from two-day old plate cultures of wild-type strain or the HP0256 mutant using 1 ml sterile PBS. Bacteria were washed twice with HAMS F12 media (Sigma, UK) and adjusted to an OD600 of 0.3. Cells were added to three wells of pre-grown AGS cells at a multiplicity of infection of 500:1 and incubated at 37°C and 5% CO2 for 3 h. Next, 1 ml of medium was removed and stored at -20°C for ELISA analysis. Cell supernatants were tested for IL-8 protein using the commercially available DuoSet ELISA kit (R and D Systems, Minneapolis, MN) as per manufacturer's instructions.

                  An H. pylori adhesion assay was performed to measure bacterial cells adhering to the AGS monolayer [56]. The remaining medium was discarded and the AGS cells were washed three times with room temperature HAMS F12 media. AGS cells were then treated with 1 ml of 0.2 μM filter-sterilized saponin (Sigma) for 15 min at 37°C. Lysed cells were collected into a sterile 1.5 ml tube and centrifuged for 10 min at 13,000 rpm. The pellet was resuspended in 1 ml sterile PBS. Dilutions were prepared and plated in duplicate on CBA (Columbia base agar) plates. Controls were included to measure any differences in starting numbers of bacteria between strains. H. pylori colonies were counted after 48 h and averaged. Adhesion of the HP0256 mutant was expressed as a percentage of the wild-type. Experiments were performed in triplicate.

                  Declarations

                  Acknowledgements

                  H. pylori flagellum research in P. W. O'Toole's lab was supported by a Science Foundation Ireland grant from the Research Frontiers Programme. H. pylori flagellum research in S. Moore's lab is funded by a Discovery Grant from NSERC of Canada (RGPIN262138-05). We acknowledge the Wellcome Trust for supporting BμG@S (Bacterial Microarray Group at St Georges's, University of London).

                  Authors’ Affiliations

                  (1)
                  Department of Microbiology & Alimentary Pharmabiotic Centre, University College Cork
                  (2)
                  Department of Biochemistry, University of Saskatchewan
                  (3)
                  School of Biosciences, University of Birmingham
                  (4)
                  Bacterial Microarray Group, Division of Cellular and Molecular Medicine, St George's University of London

                  References

                  1. Graham DY, Lew GM, Evans DG, Evans DJ Jr, Klein PD: Effect of triple therapy (antibiotics plus bismuth) on duodenal ulcer healing. A randomized controlled trial. Ann Intern Med 1991, 115:266–269.PubMed
                  2. Veldhuyzen van Zanten SJ, Sherman PM: Helicobacter pylori infection as a cause of gastritis, duodenal ulcer, gastric cancer and nonulcer dyspepsia: a systematic overview. CMAJ 1994, 150:177–185.PubMed
                  3. EUROGAST: An international association between Helicobacter pylori : infection and gastric cancer. Lancet 1993, 341:1359–1362.View Article
                  4. Parsonnet J, Hansen S, Rodriguez L, Gelb AB, Warnke RA, Jellum E, Orentreich N, Vogelman JH, Friedman GD: Helicobacter pylori infection and gastric lymphoma. N Engl J Med 1994, 330:1267–1271.PubMedView Article
                  5. Eaton KA, Morgan DR, Krakowka S: Motility as a factor in the colonisation of gnotobiotic piglets by Helicobacter pylori . J Med Microbiol 1992, 37:123–127.PubMedView Article
                  6. Eaton KA, Suerbaum S, Josenhans C, Krakowka S: Colonization of gnotobiotic piglets by Helicobacter pylori deficient in two flagellin genes. Infect Immun 1996, 64:2445–2448.PubMed
                  7. Galkin VE, Yu X, Bielnicki J, Heuser J, Ewing CP, Guerry P, Egelman EH: Divergence of quaternary structures among bacterial flagellar filaments. Science 2008, 320:382–385.PubMedView Article
                  8. Niehus E, Gressmann H, Ye F, Schlapbach R, Dehio M, Dehio C, Stack A, Meyer TF, Suerbaum S, Josenhans C: Genome-wide analysis of transcriptional hierarchy and feedback regulation in the flagellar system of Helicobacter pylori . Mol Microbiol 2004, 52:947–961.PubMedView Article
                  9. Scarlato V, Delany I, Spohn G, Beier D: Regulation of transcription in Helicobacter pylori : simple systems or complex circuits? Int J Med Microbiol 2001, 291:107–117.PubMedView Article
                  10. Pereira L, Hoover TR: Stable accumulation of sigma 54 in Helicobacter pylori requires the novel protein HP0958. J Bacteriol 2005, 187:4463–4469.PubMedView Article
                  11. Ryan KA, Karim N, Worku M, Moore SA, Penn CW, O'Toole PW: HP0958 is an essential motility gene in Helicobacter pylori . FEMS Microbiol Lett 2005, 248:47–55.PubMedView Article
                  12. Brahmachary P, Dashti MG, Olson JW, Hoover TR: Helicobacter pylori FlgR is an enhancer-independent activator of sigma 54-RNA polymerase holoenzyme. J Bacteriol 2004, 186:4535–4542.PubMedView Article
                  13. Colland F, Rain J-C, Gounon P, Labigne A, Legrain P, De Reuse H: Identification of the Helicobacter pylori anti-sigma 28 factor. Mol Microbiol 2001, 41:477–487.PubMedView Article
                  14. Josenhans C, Niehus E, Amersbach S, Horster A, Betz C, Drescher B, Hughes KT, Suerbaum S: Functional characterization of the antagonistic flagellar late regulators FliA and FlgM of Helicobacter pylori and their effects on the H. pylori transcriptome. Mol Microbiol 2002, 43:307–322.PubMedView Article
                  15. Macnab RM: How bacteria assemble flagella. Ann Rev Microbiol 2003, 57:77–100.View Article
                  16. Auvray F, Thomas J, Fraser GM, Hughes C: Flagellin polymerisation control by a cytosolic export chaperone. J Mol Biol 2001, 308:221–229.PubMedView Article
                  17. Bennett JCQ, Thomas JD, Fraser GM, Hughes C: Substrate complexes and domain organization of the Salmonella flagellar export chaperones FlgN and FliT. Mol Microbiol 2001, 39:781–791.PubMedView Article
                  18. Fraser GM, Bennett JC, Hughes C: Substrate-specific binding of hook-associated proteins by FlgN and FliT, putative chaperones for flagellum assembly. Mol Microbiol 1999, 32:569–580.PubMedView Article
                  19. Bennett JC, Hughes C: From flagellum assembly to virulence: the extended family of type III export chaperones. Trends Microbiol 2000, 8:202–204.PubMedView Article
                  20. Pallen MJ, Matzke NJ: From the origin of species to the origin of bacterial flagella. Nat Rev Micro 2006, 4:784–790.View Article
                  21. Pallen MJ, Penn CW, Chaudhuri RR: Bacterial flagellar diversity in the post-genomic era. Trends Microbiol 2005, 13:143–149.PubMedView Article
                  22. Alm RA, Trust TJ: Analysis of the genetic diversity of Helicobacter pylori : the tale of two genomes. J Mol Med 1999, 77:834–846.PubMedView Article
                  23. Tomb J-F, White O, Kerlavage AR, Clayton RA, Sutton GG, Fleischmann RD, Ketchum KA, Klenk HP, Gill S, Dougherty BA, et al.: The complete genome sequence of the gastric pathogen Helicobacter pylori . Nature 1997, 388:539–547.PubMedView Article
                  24. O'Toole PW, Lane MC, Porwollik S: Helicobacter pylori motility. Microbes Infect 2000, 2:1207–1214.PubMedView Article
                  25. Boneca IG, de Reuse H, Epinat JC, Pupin M, Labigne A, Moszer I: A revised annotation and comparative analysis of Helicobacter pylori genomes. Nucleic Acids Res 2003, 31:1704–1714.PubMedView Article
                  26. Ryan KA, Karim N, Worku M, Penn CW, O'Toole PW: Helicobacter pylori flagellar hook-filament transition is controlled by a FliK functional homolog encoded by the gene HP0906. J Bacteriol 2005, 187:5742–5750.PubMedView Article
                  27. Fraser GM, Gonzalez-Pedrajo B, Tame JRH, Macnab RM: Interactions of FliJ with the Salmonella type III flagellar export apparatus. J Bacteriol 2003, 185:5546–5554.PubMedView Article
                  28. Minamino T, Chu R, Yamaguchi S, Macnab RM: Role of FliJ in flagellar protein export in Salmonella . J Bacteriol 2000, 182:4207–4215.PubMedView Article
                  29. Evans LD, Stafford GP, Ahmed S, Fraser GM, Hughes C: An escort mechanism for cycling of export chaperones during flagellum assembly. Proc Natl Acad Sci USA 2006, 103:17474–17479.PubMedView Article
                  30. McDonnell AV, Jiang T, Keating AE, Berger B: Paircoil2: improved prediction of coiled coils from sequence. Bioinformatics 2006, 22:356–358.PubMedView Article
                  31. Gruber M, Soding J, Lupas AN: Comparative analysis of coiled-coil prediction methods. J Struct Biol 2006, 155:140–145.PubMedView Article
                  32. Alm RA, Ling L-SL, Moir DT, King BL, Brown ED, Doig PC, Smith DR, Noonan B, Guild BC, deJonge BL, et al.: Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori . Nature 1999, 397:176–180.PubMedView Article
                  33. O'Toole PW, Kostrzynska M, Trust TJ: Non-motile mutants of Helicobacter pylori and Helicobacter mustelae defective in flagellar hook production. Mol Microbiol 1994, 14:691–703.PubMedView Article
                  34. Spohn G, Scarlato V: Motility of Helicobacter pylori is coordinately regulated by the transcriptional activator FlgR, an NtrC homolog. J Bacteriol 1999, 181:593–599.PubMed
                  35. Higgs PI, Myers PS, Postle K: Interactions in the TonB-dependent energy transduction complex: ExbB and ExbD form homomultimers. J Bacteriol 1998, 180:6031–6038.PubMed
                  36. Letain TE, Postle K: TonB protein appears to transduce energy by shuttling between the cytoplasmic membrane and the outer membrane in Escherichia coli . Mol Microbiol 1997, 24:271–283.PubMedView Article
                  37. de Boer PA, Crossley RE, Hand AR, Rothfield LI: The MinD protein is a membrane ATPase required for the correct placement of the Escherichia coli division site. Embo J 1991, 10:4371–4380.PubMed
                  38. Raskin DM, de Boer PA: MinDE-dependent pole-to-pole oscillation of division inhibitor MinC in Escherichia coli . J Bacteriol 1999, 181:6419–6424.PubMed
                  39. Rothfield L, Justice S, Garcia-Lara J: Bacterial cell division. Annu Rev Genet 1999, 33:423–448.PubMedView Article
                  40. Suerbaum S, Josenhans C, Labigne A: Cloning and genetic characterization of the Helicobacter pylori and Helicobacter mustelae flaB flagellin genes and construction of H. pylori flaA - and flaB -negative mutants by electroporation-mediated allelic exchange. J Bacteriol 1993, 175:3278–3288.PubMed
                  41. Francis NR, Sosinsky GE, Thomas D, DeRosier DJ: Isolation, characterization and structure of bacterial flagellar motors containing the switch complex. J Mol Biol 1994, 235:1261–1270.PubMedView Article
                  42. Yamaguchi S, Aizawa S, Kihara M, Isomura M, Jones CJ, Macnab RM: Genetic evidence for a switching and energy-transducing complex in the flagellar motor of Salmonella typhimurium . J Bacteriol 1986, 168:1172–1179.PubMed
                  43. McMurry JL, Murphy JW, Gonzalez-Pedrajo B: The FliN-FliH interaction mediates localization of flagellar export ATPase FliI to the C ring complex. Biochemistry 2006, 45:11790–11798.PubMedView Article
                  44. Boren T, Falk P, Roth KA, Larson G, Normark S: Attachment of Helicobacter pylori to human gastric epithelium mediated by blood group antigens. Science 1993, 262:1892–1895.PubMedView Article
                  45. Jones AC, Logan RP, Foynes S, Cockayne A, Wren BW, Penn CW: A flagellar sheath protein of Helicobacter pylori is identical to HpaA, a putative N-acetylneuraminyllactose-binding hemagglutinin, but is not an adhesin for AGS cells. J Bacteriol 1997, 179:5643–5647.PubMed
                  46. Lee WK, An YS, Kim KH, Kim SH, Song JY, Ryu BD, Choi YJ, Yoon YH, Baik SC, Rhee KH, et al.: Construction of a Helicobacter pylori-Escherichia coli shuttle vector for gene transfer in Helicobacter pylori . Appl Environ Microbiol 1997, 63:4866–4871.PubMed
                  47. O'Toole PW, Kostrzynska M, Trust TJ: Non-motile mutants of Helicobacter pylori and Helicobacter mustelae defective in flagellar hook production. Mol Microbiol 1994, 14:691–703.PubMedView Article
                  48. Yao RJ, Alm RA, Trust TJ, Guerry P: Construction of new Campylobacter cloning vactors and a new mutational cat cassette. Gene 1993, 130:127–130.PubMedView Article
                  49. Sambrook J, Russell DW: Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y; 2001.
                  50. Sanderson KE, MacLachlan PR, Hessel A: Electrotransformation in Salmonella. Methods Mol Biol 1995, 47:115–123.PubMed
                  51. Langford ML, Zabaleta J, Ochoa AC, Testerman TL, McGee DJ: In vitro and in vivo complementation of the Helicobacter pylori arginase mutant using an intergenic chromosomal site. Helicobacter 2006, 11:477–493.PubMedView Article
                  52. Sambrook J, Fritsch EF, Maniatis T: Molecular cloning: a laboratory manual. 2nd edition. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989.
                  53. Towbin H, Staehelin T, Gordon J: Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA 1979, 76:4350–4354.PubMedView Article
                  54. Douillard FP, Ryan KA, Caly DL, Hinds J, Witney AA, Husain SE, O'Toole PW: Posttranscriptional regulation of flagellin synthesis in Helicobacter pylori by the RpoN chaperone HP0958. J Bacteriol 2008, 190:7975–7984.PubMedView Article
                  55. Rozen S, Skaletsky H: Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 2000, 132:365–386.PubMed
                  56. Snelling WJ, Moran AP, Ryan KA, Scully P, McGourty K, Cooney JC, Annuk H, O'Toole PW: HorB (HP0127) is a gastric epithelial cell adhesin. Helicobacter 2007, 12:200–209.PubMedView Article
                  57. Odenbreit S, Till M, Haas R: Optimized BlaM-transposon shuttle mutagenesis of Helicobacter pylori allows the identification of novel genetic loci involved in bacterial virulence. Mol Microbiol 1996, 20:361–373.PubMedView Article
                  58. Heuermann D, Haas R: A stable shuttle vector system for efficient genetic complementation of Helicobacter pylori strains by transformation and conjugation. Mol Gen Genet 1998, 257:519–528.PubMedView Article
                  59. Yamaguchi S, Fujita H, Sugata K, Taira T, Iino T: Genetic analysis of H2, the structural gene for phase-2 flagellin in Salmonella. J Gen Microbiol 1984, 130:255–265.PubMed

                  Copyright

                  © Douillard et al. 2010

                  This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                  Advertisement